Aechmea aquilega

(Salisb.) Griseb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Poales/Bromeliaceae/Aechmea

At a glance

Occurrence records760

Data sources12

Biological traits15

DNA specimens2

eDNA detections2

Sources12 archives

Databases and archives Aechmea aquilega's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility760 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF760 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB · GoaT528 Mbp

01Narrative

Aechmea aquilega is a plant species in the genus Aechmea. This species is native to Brazil, Venezuela, the Guianas, Trinidad, Jamaica and Costa Rica.Kew World Checklist of Selected Plant FamiliesHokche, O., Berry, P.E. & Huber, O. (eds.) (2008). Nuevo Catálogo de la Flora Vascular de Venezuela: 1-859. Fundación Instituto Botánico de Venezuela.Martinelli, G., Magalhães Vieira, C., Gonzalez, M., Leitman, P., Piratininga, A. Ferreira da Costa, A. & Campostrini Forzza, R. (2008). Bromeliaceae da Mata Atlântica Brasileira: lista de espécies, distribuição e conservação. Rodriguésia; Revista do Instituto de Biologia Vegetal, Jardim Botânico e Estaçao Biologica do Itatiaya 59: 209-258.Versieux, L.M., Wendt, T., Batista Louzada, R. & das Graças Lapa Wanderley, M. (2008 publ. 2009). Bromeliaceae da Cadeia do Espinhaço. Megadiversidade 4: 98-110.Acevedo-Rodríguez, P. & Strong, M.T. (2012). Catalogue of seed plants of the West Indies. Smithsonian Contributions to Botany 98: 1-1192.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass1.16 mg

⚠ sources differ — TRY: 1.16 mg · GIFT: 1.3 mg

Seed mass max1.53 mg

Seed mass min1.08 mg

Life cycle & reproduction4

Deciduousnessevergreen

Life formepiphyte or lithophyte

Life spanperennial

Lifeform raunkiaer detailedlithophyte

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Epiphyteterrestrial

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Epiphyte

Habitat GIFTCaatinga (stricto sensu), Cerrado (lato sensu), Floresta Estacional Decidual, Floresta Estacional Semidecidual, Floresta Ombrófila (= Floresta Pluvial), Restinga, Vegetação Sobre Afloramentos Rochosos

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Aechmea aquilega has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences2

eDNA detections2

The DNA barcodea real sequence read deposited for this species

rbcLJN202111.1 ↗632 bp

ACGT

TACAAATTGACTTATTATACTCCTGAGTACGAAACCAAAGATACTGATATCTTGGCAGCATTCCGAGTAACTCCTCAACCCGGAGTTCCG …

Aechmea aquilega ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1

plant barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Aechmea aquilega carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size528 120 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Aechmea aquilega0.53 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 50 n = 25

Ploidy2× diploid · measured

Chromosome records50–502n range50median50mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 502×GoaT · Kew Plant DNA C-values Database · CCDB · kew

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · kew — Gitaí J, Paule J, Zizka G, Schulte K, Benko-Iseppon AM. 2014. Chromosome numbers and DNA content in Bromeliaceae: additional data and critical review. Botanical Journal of the Linnean Society 176: 349-368.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type760 records

Wild obs. + sensor278

Museum / vouchered482

Origin

Native182

Range

Area of Occupancy AOO1 672 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy84% within 1 km

≤100 m 95≤1 km 57≤10 km 18>10 km 12

182 georeferenced · 96 without coordinates

Open the mapobservation + sensor278

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 481 without coordinates

Open the institutions mapphysical evidence482

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions19 of 48 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Salvador, BR	56
Universidade Federal do Rio Grande do Nortelocation not on record	52
Chaguaramas, TT	43
Laboratorio de Ictiologialocation not on record	43
UFBAlocation not on record	28
Universidade Federal de Sergipe (UFS)location not on record	27
JBRJlocation not on record	21
St. Augustine, TT	19
University of Stellenboschlocation not on record	18
Bronx, US	16
UFPElocation not on record	15
Universidade Federal do Vale do São Franciscolocation not on record	14
Feira de Santana, BR	14
Kew, GB	10
Departamento de Sistematica e Ecologialocation not on record	10
Universidade Federal do Ceara, Departamento de Biologialocation not on record	10
CEPLAClocation not on record	10
Fortaleza, BR	9
Université de Bordeauxlocation not on record	8
UNIVASFlocation not on record	6
Chicago, US	5
Cruz das Almas, BR	4
IPA/SPlocation not on record	3
Saint Louis, US	3
UEMAlocation not on record	3
INMAlocation not on record	2
Santa Teresa, BR	2
HACAMlocation not on record	2
UESBlocation not on record	2
Teresina, BR	2
UFRPElocation not on record	2
Madison, US	2
Universidade Federal de Santa Catarinalocation not on record	1
UFSClocation not on record	1
ASUlocation not on record	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Ural Federal University "B. N. Yeltsin"location not on record	1
Göteborg, SE	1
Brasília, BR	1
UNICAMPlocation not on record	1
Tampa, US	1
Cenargenlocation not on record	1
BISHlocation not on record	1
Altos de Pipe, VE	1
Honolulu, US	1
South Kensington, GB	1
Instituto do Meio Ambientelocation not on record	1
UFVJMlocation not on record	1

48 institutions · 477 of 482 vouchered records shown · 5 without an institution code

09Environmental DNA2 detections

Where the DNA of Aechmea aquilega was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)