Adscita geryon

(Hübner) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Zygaenidae/Adscita

At a glance

Occurrence records7 621

Data sources9

Biological traits2

DNA specimens88

eDNA detections86

Sources9 archives

Databases and archives Adscita geryon's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility7 621 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI86 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics88 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF7 621 records

Environmental DNA1 datasets · 13 countries86 detections

DNA & barcodingBOLD88 specimens

Genome at a glanceGoaT · NCBI≈765 Mbp

01Narrative

Adscita geryon, the cistus forester, is a moth of the family Zygaenidae. It is found in southern and central Europe, east to Turkey. It is also present in Great Britain.Hans-Josef Weidemann, Jochen Köhler: Nachtfalter, Spinner und Schwärmer, S. 476ff, Naturbuch-Verlag, Augsburg 1996, The wingspan is 20–25 mm.UKmoths Adults are on wing in July in one generation per year. They feed on the nectar of Gymnadenia species.Eyjolf Aistleitner, Die Widderchen oder Bluts tropfchen Vorarlbergs, Austria occ., Zeitschrift der Arbeitsgemeinschaft Österr. Entomologen, 42. Jg, 1990 The warm habitat is dry grasslands and alpine meadows up to an altitude of 2,400 meters. The larvae feed on Helianthemum nummularium. Young larvae mine the leaves of their host plant. They create a number of fleck mines. The opening of the mine is a slit at the side. The mines contain little or no frass. Older larvae live free on the plant. The larvae can be found from July to May of the following year.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)nectivore

Feeding guild (larval)herbivore

05DNA & barcoding88 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adscita geryon has left across the world's sequence archives.

At a glance

DNA specimens88

BINs5

Marker genes2

eDNA detections86

Countries13

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus85 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 30 variable positions, in barcode order

38Gmostly conserved

40Gvariable

59Cmostly conserved

64Tmostly conserved

70Amostly conserved

74Tmostly conserved

82Cmostly conserved

88Amostly conserved

133Cvariable

139Cmostly conserved

166Amostly conserved

200Gmostly conserved

220Tmostly conserved

235Tvariable

238Amostly conserved

268Tmostly conserved

312Cmostly conserved

368Gmostly conserved

386Tmostly conserved

391Gmostly conserved

421Amostly conserved

457Tmostly conserved

514Amostly conserved

526Tmostly conserved

553Gvariable

581Tmostly conserved

601Tmostly conserved

607Cmostly conserved

619Tmostly conserved

640Tmostly conserved

AACACTTTATTTTATTTTTGGTATTTGATCAGGAATAGTGGGAACATCATTAAGTTTACTAATTCGTACAGAATTAGGAACCCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.4%

Haplotypes35

BINs5

Most divergent pair4.1%

EuropeOtherAsia

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adscita bolivarisame genus2.3%Adscita manniisame genus2.4%Adscita alpinasame genus2.6%Adscita italicasame genus2.7%Adscita jordanisame genus2.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT · NCBI

The complete instruction manual Adscita geryon carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈764 633 620 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Adscita geryon0.76 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 321×GoaT · de Vos et al. 2020

GoaT · de Vos et al. 2020 — ↗

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98% BUSCO

08Occurrence & distribution

Record type7 621 records

Wild obs. + sensor4 690

Museum / vouchered2 847

Cultivated / captive2

Other82

Origin

Native1 992

Range

Area of Occupancy AOO6 768 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy14% within 1 km

≤100 m 320≤1 km 333≤10 km 3 828>10 km 62

4 543 georeferenced · 147 without coordinates

Open the mapobservation + sensor4 690

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy8% within 1 km

≤100 m 19≤1 km 211≤10 km 2 509>10 km 11

2 750 georeferenced · 97 without coordinates

Open the institutions mapphysical evidence2 847

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions14 of 35 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Musee d'Histoire Naturallelocation not on record	399
Zürich, CH	341
Salzburg, AT	111
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	79
Vitoria, ES	59
Bern, CH	46
Frauenfeld, CH	39
Archäologie und Museum Baselland - Museum.BLlocation not on record	33
Dhaka, BD	33
Sion, CH	28
Geneva, CH	22
John May Museum of Natural Historylocation not on record	17
NMOKlocation not on record	16
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	15
Museum zu Allerheiligen Schaffhausenlocation not on record	14
CASMlocation not on record	12
Paro, BT	7
Naturmuseum St. Gallenlocation not on record	6
Adam Mickiewicz University in Poznańlocation not on record	6
Fribourg, CH	6
Philadelphia, US	5
Natural History Museum Rotterdamlocation not on record	5
Glarus, CH	4
Provincia di Livornolocation not on record	3
CBDClocation not on record	3
Muzeum Górnośląskie w Bytomiulocation not on record	3
EGBlocation not on record	2
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	2
SFRAlocation not on record	2
ZSMlocation not on record	1
DFlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
Uniwersytet Łódzkilocation not on record	1
New Haven, US	1
South Kensington, GB	1

35 institutions · 1 324 of 2 847 vouchered records shown · 1 523 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA86 detections

Where the DNA of Adscita geryon was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found86

Studies independent surveys1

Countries13

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 86 detections have coordinates

Open the map13 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median14.2 °C 8.70–20.5

Seasonal swing summer↔winter19.9 °C

Max temp (day)19.0 °C 13.2–23.4

Min temp (night)9.20 °C 2.40–14.8

Precipitation99.0 mm/mo 50.5–270

Air humidity60.2 % 56.6–63.2

Moisture balance-34.9 mm/mo -97.7–145

Vapour deficit687 Pa 433–961

Wind speed3.30 m/s 1.90–4.50

Cloud cover36.6 % 31.1–40.8

CHELSA 1981–2010, ~9 km grid, at location & month of 76 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Adscita geryon

At a glance

Sources9 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Sequencing statusassembly quality — how far to trust these numbers

Record type7 621 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions14 of 35 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type7 621 records