Adromischus cooperi

(Baker) A.Berger · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Saxifragales/Crassulaceae/Adromischus

At a glance

Occurrence records27

Data sources11

Biological traits14

DNA specimens1

eDNA detections1

Sources11 archives

Databases and archives Adromischus cooperi's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility27 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources14 traits

Occurrence & distributionGBIF27 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

Genome at a glanceCCDB2n = 18

01Narrative

Adromischus cooperi is a species of succulent plant from the family Crassulaceae. The genus name Adromischus comes from ancient Greek adros (meaning "thick") and mischos ( meaning "stem"), and the species name from James Graham Cooper, an American naturalist and surgeon. The plant is endemic to the Eastern Cape of South Africa.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology2

Plant height max0.34 m

Plant height min0.1 m

Life cycle & reproduction2

Life formsucculent subshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 500 m

Elevation min700 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adromischus cooperi has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes3

GenBank sequences4

eDNA detections1

The DNA barcodea real sequence read deposited for this species

ITSMH503496.1 ↗665 bp

ACGT

GAAGTCGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAGCCCATAAAGCACGACCGCGAACAAGTTGTCAATCGGG …

Adromischus cooperi voucher Bruyns 11921 (UPS) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Adromischus cooperi carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 18 n = 9

Ploidydiploid inferred

Chromosome records18–182n range18median18mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 182×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Uhl 1948

CCDB · book-atlas-flowering-plants — Uhl 1948

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type27 records

Wild obs. + sensor18

Museum / vouchered8

Cultivated / captive1

Range

Area of Occupancy AOO80 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 11≤1 km 2≤10 km 1>10 km 1

15 georeferenced · 3 without coordinates

Open the mapobservation + sensor18

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 8 records without

Open the institutions mapphysical evidence8

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 1 records without

Open the mapnot free-living1

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	6
Cape Town, ZA	2

2 institutions · 8 of 8 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA1 detections

Where the DNA of Adromischus cooperi was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)