Adoxophyes templana

(Pagenstecher, 1900) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Tortricidae/Adoxophyes

At a glance

Occurrence records128

Data sources8

Biological traits0

DNA specimens37

eDNA detections1

Sources8 archives

Databases and archives Adoxophyes templana's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility128 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics37 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF128 records

Environmental DNA1 datasets · 1 countries1 detections

DNA & barcodingBOLD37 specimens

01Narrative

Adoxophyes templana is a species of moth of the family Tortricidae. It is found in Australia (the Northern Territory and Queensland), but also on the Bismarck Archipelago.tortricidae.com The wingspan is about 15 mm. The forewings are pale brown with irregular variable broad dark brown lines. The larvae feed on Citrus, Rhizophora stylosa, Aegiceras corniculatum, Excoecaria agallocha, Melaleuca dealbata and Melaleuca quinquenervia. They are a pest in Citrus orchards. They attack the rind of the developing fruit of their host plant.Australian Insects

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding37 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adoxophyes templana has left across the world's sequence archives.

At a glance

DNA specimens37

BINs1

Marker genes1

eDNA detections1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus32 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

85Tvariable

190Amostly conserved

TACATTATATTTTATTTTTGGAATTTGAGCCGGAATAATCGGAACATCATTGAGACTATTAATTCGAGCCGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.12%

Haplotypes5

BIN1

Most divergent pair0.46%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adoxophyes moderatanasame genus7.1%Archips crataeganasame family7.4%Adoxophyes parastrophasame genus7.6%Adoxophyes trirhabdasame genus8.1%Adoxophyes panxanthasame genus8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type128 records

Wild obs. + sensor49

Museum / vouchered79

Range

Area of Occupancy AOO168 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy83% within 1 km

≤100 m 14≤1 km 21≤10 km 1>10 km 6

42 georeferenced · 7 without coordinates

Open the mapobservation + sensor49

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy14% within 1 km

≤100 m 1≤10 km 6

7 georeferenced · 72 without coordinates

Open the institutions mapphysical evidence79

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Fish Collectionlocation not on record	6
Australian National Insect Collectionlocation not on record	3
Sydney, AU	1

3 institutions · 10 of 79 vouchered records shown · 69 without an institution code

09Environmental DNA1 detections

Where the DNA of Adoxophyes templana was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median20.2 °C 20.2–20.2

Seasonal swing summer↔winter6.80 °C

Max temp (day)20.8 °C

Min temp (night)19.2 °C

Precipitation39.6 mm/mo

Air humidity60.8 %

Moisture balance-104 mm/mo

Vapour deficit927 Pa

Wind speed5.20 m/s

Cloud cover30.3 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)