Adonis volgensis

DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Adonis

At a glance

Occurrence records2 259

Data sources4

Biological traits10

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Adonis volgensis's data was compiled from.

GBIFGlobal Biodiversity Information Facility2 259 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements2 literature sources10 traits

Occurrence & distributionGBIF2 259 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 16

02Traits & measurements

SourcesWCVPGIFT

Size & morphology2

Plant height max0.3 m

Plant height min0.15 m

Life cycle & reproduction4

Flowering endApr

Flowering startApr

Life formperennial

Life spanperennial

Habitat & environment4

Climatetemperate

Growth formherb

Habitat GIFTforest edges, meadows, steppe

Woodinessnon-woody

05DNA & barcoding10 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adonis volgensis has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences10

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOR699363.1 ↗499 bpKazakhstan

ACGT

TCGTGGGGCGAGAGGGGGCGTAAGCCCTCGATCGTCCCATTATCGGGACATGGGAACGGCTTCGGTCGAACTGTGCTCCCGTACGAACAA …

Adonis volgensis voucher AKM22-069 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL4★ITS3

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Adonis volgensis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 161×CCDB · iapt

CCDB · iapt — IAPT/IOPB Chromosome Data 35

08Occurrence & distribution

Record type2 259 records

Wild obs. + sensor1 988

Museum / vouchered271

Range

Area of Occupancy AOO3 308 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 939≤1 km 308≤10 km 94>10 km 43

1 384 georeferenced · 604 without coordinates

Open the mapobservation + sensor1 988

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy23% within 1 km

≤1 km 28≤10 km 88>10 km 8

124 georeferenced · 147 without coordinates

Open the institutions mapphysical evidence271

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	124
Vitebsk State University named after P.M. Masherovlocation not on record	54
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	29
LDlocation not on record	12
Voronezh State Universitylocation not on record	9
BRNUlocation not on record	4
Samara National Research Universitylocation not on record	2
Berlin, DE	2
BClocation not on record	2
Mlocation not on record	1
Dresden, DE	1
Helsinki, FI	1

12 institutions · 241 of 271 vouchered records shown · 30 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Adonis volgensis

At a glance

Sources4 archives

Size & morphology2

Life cycle & reproduction4

Habitat & environment4

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type2 259 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 12 geolocated

Record type2 259 records