Adonis pyrenaica

DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Ranunculaceae/Adonis

At a glance

Occurrence records1 483

Data sources6

Biological traits4

DNA specimens0

eDNA detections0

Sources6 archives

Databases and archives Adonis pyrenaica's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 483 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements2 literature sources4 traits

Occurrence & distributionGBIF1 483 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 16

02Traits & measurements

SourcesWCVPGIFT

Life cycle & reproduction1

Life formperennial

Habitat & environment3

Climatetemperate

Growth formherb

Woodinessnon-woody

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adonis pyrenaica has left across the world's sequence archives.

At a glance

Marker genes3

GenBank sequences4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPQ872293.1 ↗681 bpFrance

ACGT

CGTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCTCTGCAGAACGACCCGTGAACACGTGAAACAATATTG …

Adonis pyrenaica voucher Chas 10292 (K) small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Adonis pyrenaica carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 16 n = 8

Ploidydiploid inferred

Chromosome records16–242n range16median16mode11records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 1610×CCDB · iapt · CCDB · ipcn-api-dl · CCDB · book-ipcn75-78 +2

CCDB · iapt — IAPT/IOPB Chromosome Data 8

CCDB · ipcn-api-dl — Lavrenko, A. N. & N. P. Serditov. 1985. Karyosystematic study of Ranunculaceae and Paeoniaceae in the north-east of the European part of the USSR. Bot. Zhurn. SSSR 70(10): 1346–1354.

CCDB · ipcn-api-dl — Shrager, L. N. 1980. Polimorfizm sputnichnykh khromosom neskol, kikh populjacij Adonis sibirica Patr. Problemy Populjacionnoj i Evolucionnoj Citogenetiki Rastenij i Zhivotnykh. 51–56.

CCDB · ipcn-api-dl — Kartashova, N. N., L. A. MALAKHOVA, Koslova & N. A. Dubrova. 1974. Chisla chromosom u rjada polesnykh rastenij is prirodnykh populjacij flory Priob'ja. Biol. Biofis. Tomsk. 47–53.

CCDB · ipcn-api-dl — Malakhova, L. A. 1990. Kariologocheskij analiz prirodnykh populjacij redkich i ischezajushchikh rastenij na juge Tomskoj Oblasti. Bjulleten' Glavnogo Botanic|5eskogo Sada 155: 60–66.

CCDB · book-ipcn75-78 — Shlangena 1976

CCDB · book-ipcn75-78 — Kartashova et al. 1974

CCDB · book-ipcn75-78 — Rostovtseva 1976a

CCDB · book-ipcn73-74 — SLANGENA, Z. 1974. Cariological investigations of Adonis sibirica Patr. ( fam. Ranunculaceae ). Latvijas PSR zinatnu Akademijas vestis, (318): 25-29.

CCDB · book-fedorov — Langlet 1927a

2n 241×CCDB · iapt

CCDB · iapt — IAPT/IOPB Chromosome Data 33

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 483 records

Wild obs. + sensor1 356

Museum / vouchered127

Range

Area of Occupancy AOO656 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy15% within 1 km

≤100 m 122≤1 km 60≤10 km 974>10 km 22

1 178 georeferenced · 178 without coordinates

Open the mapobservation + sensor1 356

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy39% within 1 km

≤100 m 3≤1 km 24≤10 km 42

69 georeferenced · 58 without coordinates

Open the institutions mapphysical evidence127

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions12 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
BDBClocation not on record	31
BClocation not on record	30
Barcelona, ES	29
Vitoria, ES	8
MAlocation not on record	7
Entomological Society of Latvialocation not on record	4
Madrid, ES	2
Oskarshamn, SE	1
IPE-CSIClocation not on record	1
Gijón, ES	1
Salamanca, ES	1
Universidad del Pais Vasco (UPV/EHU)location not on record	1
Montréal, CA	1
Arequipa, PE	1
Granada, ES	1
Bourges, FR	1
València, ES	1
Jaén, ES	1

18 institutions · 122 of 127 vouchered records shown · 5 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Adonis pyrenaica

At a glance

Sources6 archives

Life cycle & reproduction1

Habitat & environment3

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 483 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions12 of 18 geolocated

Record type1 483 records