Adonis aestivalis
speciesAt a glance
Occurrence records14 395
Data sources10
Biological traits41
DNA specimens3
eDNA detections2
Sources10 archives
Databases and archives Adonis aestivalis's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility14 395 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics3 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
PloiDBPloidy Databasegenome & karyotypeOn this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources41 traits
Chemical compositionLOTUS8 compounds
Occurrence & distributionGBIF14 395 records
Environmental DNA1 datasets · 1 countries2 detections
DNA & barcodingBOLD · NCBI3 specimens
Genome at a glanceCCDB2n = 32
01Narrative
L'adonis d'été, localement appelé « goutte de sang » ou « œil de faisan » est une espèce de plantes à fleurs de la famille des Ranunculaceae. C'est une plante herbacée annuelle originaire d'Eurasie.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesGIFTLEDATRYWCVP
Size & morphology10
Leaf mass4.6 mg
Leaf size194 mm²
Plant height0.237 m
⚠ sources differ — GIFT: 0.237 m · LEDA: 0.325 m · TRY: 0.413 m
Plant height generative0.4 m
Plant height max0.6 m
Plant height min0.1 m
Seed length5.13 mm
Seed mass7 mg
⚠ sources differ — TRY: 7 mg · LEDA: 11.52 mg · GIFT: 9.24 mg
Seed mass max10 mg
Seed mass min4.27 mg
Life cycle & reproduction14
Deciduousnessdeciduous
Dehiscenceindehiscent
Dispersal typehuman
⚠ sources differ — LEDA: speirochor · GIFT: autochorous
Flowering endAug
Flowering startApr
Life formannual
Life spanannual
Lifespan years1 years
Pollination modebiotic
Pollination syndromeinsect
Raunkiær life formtherophyte
Reproduction asexualabsent
Seed number62.5
Self fertilizationpresent
Diet & foraging2
Carnivorynon-carnivorous
Parasiteindependent
Habitat & environment11
Aquaticterrestrial
Climatetemperate
Climberself-supporting
Elevation max2 700 m
Elevation min1 000 m
Epiphyteterrestrial
Fruit typeachene
Growth formherb
Habitat GIFTcrop fields, meadows, mountains, saline places, shrubberies, stony places
Mycorrhiza typearbuscular
Woodinessnon-woody
Physiology & chemistry3
Leaf dry-matter content (LDMC)135 mg/g
⚠ sources differ — TRY: 135 mg/g · LEDA: 120 mg/g
Photosynthetic pathwayC3
Specific leaf area (SLA)42.07 mm²/mg
Other traits1
Diaspore typefruitlet
03Chemical composition8 compounds
Compounds documented for Adonis aestivalis across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile2 classes
Cardenolides6
Aporphine alkaloids $ Isoquinoline alkaloids2
Documented compounds8 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (+)-Corytuberine | present | LOTUS | |
| (+)-Magnoflorine | present | LOTUS | |
| (3S,5S,8R,9S,10S,13R,14S,17R)-5,14-dihydroxy-3-[(2R,4S,5S,6R)-4-hydroxy-5-[(2S,4R,5S,6S)-4-methoxy-6-methyl-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-6-methyloxan-2-yl]oxy-13-methyl-17-(5-oxo-2H-furan-3-yl)-2,3,4,6,7,8,9,11,12,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthrene-10-carbaldehyde | present | LOTUS | |
| (3S,5S,8R,9S,10S,13R,14S,17R)-5,14-dihydroxy-3-[(2R,4S,5S,6R)-4-hydroxy-5-[(2S,4S,5S,6R)-4-hydroxy-5-[(2S,4R,5S,6R)-4-methoxy-6-methyl-5-[(2S,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxyoxan-2-yl]oxy-6-methyloxan-2-yl]oxy-6-methyloxan-2-yl]oxy-13-methyl-17-(5-oxo-2H-furan-3-yl)-2,3,4,6,7,8,9,11,12,15,16,17-dodecahydro-1H-cyclopenta[a]phenanthrene-10-carbaldehyde | present | LOTUS | |
| 3-[(3R,5S,8R,9S,10R,13R,14S,17R)-3,5,14-trihydroxy-3,10,13-trimethyl-1,2,4,6,7,8,9,11,12,15,16,17-dodecahydrocyclopenta[a]phenanthren-17-yl]-2H-furan-5-one | present | LOTUS | |
| 3-epi-Periplogenin | present | LOTUS | |
| Helveticoside | present | LOTUS | |
| Strophanthidin | present | LOTUS |
05DNA & barcoding3 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adonis aestivalis has left across the world's sequence archives.
At a glance
DNA specimens3
Marker genes3
GenBank sequences10
eDNA detections2
Countries2
The DNA barcodea real sequence read deposited for this species
TCGAAACCTGCTCAGCAGAACGACCCGCGAACACGTGAATCAACACTGCTGTGGGACGAGCGGGGGTGCGAGCCCTCGGTCGTTCCATTG …
Adonis aestivalis voucher WHB 68961 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★matK3★rbcL5★ITS2
plant barcodefungal barcode
06Genome at a glanceCCDB
The complete instruction manual Adonis aestivalis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 32 n = 16
Ploidypolyploid inferred
Chromosome records16–642n range32median32mode33records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 3222×CCDB · slov-fl · CCDB · poland · CCDB · mediterranean +5
CCDB · slov-fl — Májovský J. et al., 1978: Index of chromosome numbers of Slovakian flora (Part 6). - Acta Fac. Rerum Nat. Univ. Comen., Bot. 26: 1-42.
CCDB · poland — Pogan E., Wcis?o H., Jankun A. et al. 1980 b. Further studies in chromosome numbers of Polish Angiosperms. Part XIII. Acta Biol. Cracov. Ser. Bot. 22, 37-69.
CCDB · mediterranean
CCDB · ipcn-api-dl — Reynaud, C., R. Verlaque & D. Filosa. 1993. Mediterranean chromosome number reports 3 (234--239). Fl. Medit. 3: 367–373.
CCDB · book-ipcn75-78 — Murin 1978
CCDB · book-ipcn75-78 — Hindakova 1978
CCDB · book-ipcn75-78 — Shlangena 1976
CCDB · book-fedorov — Langlet 1927a
CCDB · book-fedorov — Gregory W. C. 1941
CCDB · book-fedorov — Kurita 1963b (I. 1963)
CCDB · book-fedorov — Delay 1947
CCDB · Cave1963 — Kurita 1963
CCDB · CromoCat 2015 — Koeva-Todorovskaya, I. & Nenova, I. (1977). Karyological study of some Ranunculaceae taxa growing in Bulgaria. God. Sofijsk. Univ. 70(2): 35-48.
CCDB · CromoCat 2015 — Pogan, E., H. Wisclo & A. Jankun. (1980). Further studies in chromosome numbers of Polish Angiosperms. Part XIII. Acta Biol. Cracov., Ser. Bot. 22: 37-69.
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
CCDB · CromoCat 2015 — Galland, N. (1988). Recherche sur l'origine de la flore orophile du Maroc: Étude caryologique et cytogéographique. Trav. Inst. Scientifique Rabat, sér. Bot. 35: 1-168.
CCDB · CromoCat 2015 — Reynaud, C., R. Verlaque & D. Filosa. (1993). Reports (234-239). Fl. Medit. 3: 367-373.
CCDB · CromoCat 2015 — Shlangena, Z. E. (1976). The chromosome numbers of some Adonis L. species in URSS (Ranunculaceae). Bot. Žurn. 61: 1603-1608.
2n 165×CCDB · poland · CCDB · book-ipcn75-78 · CCDB · CromoCat 2015
CCDB · poland — Pogan E., Wcis?o H., Jankun A. et al. 1980 b. Further studies in chromosome numbers of Polish Angiosperms. Part XIII. Acta Biol. Cracov. Ser. Bot. 22, 37-69.
CCDB · book-ipcn75-78 — Shlangena 1976
CCDB · CromoCat 2015 — Pogan, E., H. Wisclo & A. Jankun. (1980). Further studies in chromosome numbers of Polish Angiosperms. Part XIII. Acta Biol. Cracov., Ser. Bot. 22: 37-69.
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
CCDB · CromoCat 2015 — Shlangena, Z. E. (1976). The chromosome numbers of some Adonis L. species in URSS (Ranunculaceae). Bot. Žurn. 61: 1603-1608.
2n 484×CCDB · ipcn-api-dl · CCDB · CromoCat 2015
CCDB · ipcn-api-dl — Heyn, C. C. & B. Pazy. 1989. The annual species of Adonis (Ranunculaceae) -- a polyploid complex. Pl. Syst. Evol. 168: 181–193.
CCDB · CromoCat 2015 — Heyn, C. C. & Pazy, B. (1989). The annual species of Adonis (Ranunculaceae) - a polyploid complex. Pl. Syst. Evol. 168: 181-193.
CCDB · CromoCat 2015 — Shlangena, Z. E. (1976). The chromosome numbers of some Adonis L. species in URSS (Ranunculaceae). Bot. Žurn. 61: 1603-1608.
2n 642×CCDB · CromoCat 2015
CCDB · CromoCat 2015 — Pogan, E., H. Wisclo & A. Jankun. (1980). Further studies in chromosome numbers of Polish Angiosperms. Part XIII. Acta Biol. Cracov., Ser. Bot. 22: 37-69.
CCDB · CromoCat 2015 — Váchová, M. (1978). Index of chromosome numbers of Slovakian flora. (Part 6). Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 26: 1-42.
n 1614×CCDB · iber-fl · CCDB · mediterranean · CCDB · ipcn-api-dl +2
CCDB · iber-fl — IOPB. Chromosome data 7 (ed. A. Stace). Diosdado, J. C. & al.Intern. Organ. Plant Biosyst.22: 3-4(1994).
CCDB · iber-fl — Nmeros cromosmicos para la flora espaola, 691-719. Diosdado, J. C. & al.Lagascalia17(1): 173-184(1993).
CCDB · mediterranean
CCDB · ipcn-api-dl — Galland, N. 1988. Recherche sur l'origine de la flore orophile du Maroc étude caryologique et cytogéographique. Trav. Inst. Sci. Univ. Mohammed V, Sér. Bot. 35: 1–168.
CCDB · ipcn-api-dl — Reynaud, C., R. Verlaque & D. Filosa. 1993. Mediterranean chromosome number reports 3 (234--239). Fl. Medit. 3: 367–373.
CCDB · ipcn-api-dl — Diosdado, J. C., C. Santa-Bárbara, J. Vioque, R. Juan & J. Pastor. 1993. Números cromosomáticos para la flora Española. 691--719. Lagascalia 17: 173–184.
CCDB · ipcn-api-dl — Diosdado, J. C., J. Vioque, R. Juan & J. Pastor. 1994. IOPB chromosome data 7. Int. Organ. Pl. Biosyst. Newslett. (Zurich) 22: 3–4.
CCDB · book-ipcn72 — BHAT, B.K., S.K. BAKSHI, & M.K. KAUL. 1972. In IOPB chromosome number reports XXXVIII. Taxon 21: 679-684.
CCDB · CromoCat 2015 — Bhat, B. K., Bakshi, S. K. & Kaul, M. K. (1972). Reports [In Löve, A. (ed.), IOPB chromosome numbers reports XXXVIII]. Taxon 21(5/6): 680.
CCDB · CromoCat 2015 — Galland, N. (1988). Recherche sur l'origine de la flore orophile du Maroc: Étude caryologique et cytogéographique. Trav. Inst. Scientifique Rabat, sér. Bot. 35: 1-168.
CCDB · CromoCat 2015 — Castroviejo & al. (2003). Flora Iberica (vol. I-VIII, X, XIV) Publicaciones del CSIC Madrid
CCDB · CromoCat 2015 — Diosdado, J. C., Santa-Barbara, C. Vioque, J., Juan, R. & Pastor, J. (1993a). Números cromosómicos para la flora española. 691-719. Lagascalia 17(1): 173-184.
CCDB · CromoCat 2015 — Diosdado, J. C., Vioque, J., Juan, R. & Pastor, J. E. (1994). IOPB Chromosome Data 7 (ed. C.A. Stace). Int. Organ. Pl. Biosyst. Newslett. 22: 3-4.
CCDB · CromoCat 2015 — Reynaud, C., R. Verlaque & D. Filosa. (1993). Reports (234-239). Fl. Medit. 3: 367-373.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
polyploid inferred1×PloiDB · genus-scale
PloiDB · genus-scale — chromEvol; reliability=1.000 ↗
08Occurrence & distribution
Record type14 395 records
Wild obs. + sensor12 758
Museum / vouchered1 580
Other57
Origin
Native18
Introduced17
Range
Area of Occupancy AOO26 372 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy22% within 1 km
≤100 m 1 567≤1 km 596≤10 km 7 394>10 km 323
9 880 georeferenced · 2 878 without coordinates
Open the mapobservation + sensor12 758
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy35% within 1 km
≤100 m 42≤1 km 199≤10 km 420>10 km 31
692 georeferenced · 888 without coordinates
Open the institutions mapphysical evidence1 580
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions71 of 135 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Uniwersytet Wrocławskilocation not on record | 196 |
| Moscow State Universitylocation not on record | 90 |
| BRNUlocation not on record | 88 |
| Zürich, CH | 76 |
| Zürich, CH | 72 |
| Adam Mickiewicz University in Poznańlocation not on record | 62 |
| Kunming, CN | 51 |
| Museo Entomologico de Leonlocation not on record | 39 |
| Bern, CH | 38 |
| Mlocation not on record | 34 |
| Wlocation not on record | 32 |
| BFLlocation not on record | 30 |
| MeiseBGlocation not on record | 28 |
| Uniwersytet Śląski w Katowicachlocation not on record | 27 |
| Uniwersytet Jagiellońskilocation not on record | 26 |
| LDlocation not on record | 25 |
| BClocation not on record | 24 |
| MAlocation not on record | 22 |
| PRClocation not on record | 20 |
| Frankfurt am Main | 19 |
| Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record | 18 |
| LfUlocation not on record | 16 |
| Barcelona, ES | 15 |
| Canadian Department of Agriculturelocation not on record | 13 |
| Brussel, BE | 12 |
| Ernst-Moritz-Arndt-Universitat Greifswaldlocation not on record | 12 |
| Bronx, US | 11 |
| València, ES | 11 |
| Berlin, DE | 11 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 10 |
| Oskarshamn, SE | 10 |
| Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record | 10 |
| College of the Atlantic, Museumlocation not on record | 10 |
| Görlitz, DE | 9 |
| GJOlocation not on record | 9 |
| BDBClocation not on record | 9 |
| Provincia di Livornolocation not on record | 9 |
| Pullman, US | 8 |
| Porrentruy, CH | 8 |
| Uniwersytet Opolskilocation not on record | 8 |
| Corvallis, US | 8 |
| Bourges, FR | 7 |
| Kew, GB | 7 |
| GMBAlocation not on record | 7 |
| Saint Louis, US | 7 |
| WTUlocation not on record | 7 |
| CASlocation not on record | 7 |
| Vitoria, ES | 7 |
| Uniwersytet Rolniczy im. Hugona Kołłątaja w Krakowielocation not on record | 7 |
| Logan, US | 7 |
| Salzburg, AT | 6 |
| inatura Erlebnis Naturschau GmbHlocation not on record | 6 |
| Beijing, CN | 5 |
| Conservatoire botanique national du Bassin parisienlocation not on record | 5 |
| Dresden, DE | 5 |
| Helsinki, FI | 5 |
| BIO-UNIPIlocation not on record | 4 |
| Nanjing, CN | 4 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 4 |
| Fulda, DE | 4 |
| Auckland, NZ | 4 |
| Pamplona, ES | 3 |
| CJBGlocation not on record | 3 |
| Entomological Society of Latvialocation not on record | 3 |
| Claremont, US | 3 |
| Salamanca, ES | 3 |
| H-Wolflocation not on record | 3 |
| Universidad del Pais Vasco (UPV/EHU)location not on record | 3 |
| MHNAIXlocation not on record | 2 |
| Badajoz, ES | 2 |
| München, DE | 2 |
| Boise, US | 2 |
| No collectionlocation not on record | 2 |
| Uniwersytet Warszawskilocation not on record | 2 |
| Oulu, FI | 2 |
| Muséum Henri Lecoqlocation not on record | 2 |
| Rishon Le Zion, IL | 2 |
| Dhaka, BD | 2 |
| Frauenfeld, CH | 2 |
| IDElocation not on record | 2 |
| Urumqi, CN | 2 |
| IFR-DNFlocation not on record | 2 |
| UGentlocation not on record | 2 |
| SZUlocation not on record | 2 |
| Riverside, US | 2 |
| Yangling, CN | 2 |
| Provo, US | 2 |
| Xining, CN | 2 |
| John May Museum of Natural Historylocation not on record | 2 |
| Boumlocation not on record | 2 |
| Sion, CH | 2 |
| Wellington, NZ | 1 |
| University of Alberta Museumslocation not on record | 1 |
| Sede di Via Giorgio La Pira del Museo di Storia naturale di Firenze | Via Giorgio La Pira headquarter of the Natural History Museum in Florencelocation not on record | 1 |
| Universität Erlangen-Nürnberglocation not on record | 1 |
| Northridge, US | 1 |
| Granada, ES | 1 |
| Jaén, ES | 1 |
| FLADlocation not on record | 1 |
| Universidad de La Salle (La Salle)location not on record | 1 |
| Karlsruhe, DE | 1 |
| ER Kochlocation not on record | 1 |
| Salvador, BR | 1 |
| San Luis Obispo, US | 1 |
| Missoula, US | 1 |
| University of Stellenboschlocation not on record | 1 |
| Balochistan University of Information Technology, Engineering and Management Scienceslocation not on record | 1 |
| Brookings, US | 1 |
| Tampere, FI | 1 |
| Hobart, AU | 1 |
| Xian, CN | 1 |
| Museo Achille Folettolocation not on record | 1 |
| Córdoba, ES | 1 |
| Xiamen, CN | 1 |
| Phyletisches Museum Jenalocation not on record | 1 |
| Fort Worth, US | 1 |
| Dekalb, US | 1 |
| Henry Brockhouse Collectionlocation not on record | 1 |
| Columbia, US | 1 |
| Glarus, CH | 1 |
| Wuzhou, CN | 1 |
| Henderson, US | 1 |
| Durban, ZA | 1 |
| Staten Island, US | 1 |
| Tuscaloosa, US | 1 |
| Museo della Bonifica di San Donà di Piavelocation not on record | 1 |
| Madrid, ES | 1 |
| UIBlocation not on record | 1 |
| Macomb, US | 1 |
| Pocatello, US | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| South Kensington, GB | 1 |
| SLU Artdatabankenlocation not on record | 1 |
| BG-NMNHSlocation not on record | 1 |
| Arcata, US | 1 |
135 institutions · 1 452 of 1 580 vouchered records shown · 99 without an institution code
09Environmental DNA2 detections
Where the DNA of Adonis aestivalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found2
Studies independent surveys1
Countries1
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 2 detections have coordinates
Open the map1 country0
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median18.2 °C 18.2–18.2
Seasonal swing summer↔winter23.7 °C
Max temp (day)23.2 °C
Min temp (night)11.2 °C
Precipitation29.4 mm/mo
Air humidity35.5 %
Moisture balance-164 mm/mo
Vapour deficit1,366 Pa
Wind speed4.70 m/s
Cloud cover22.9 %
CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.