Adomerus triguttulus

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cydnidae/Adomerus

At a glance

Occurrence records206

Data sources4

Biological traits0

DNA specimens3

eDNA detections7

Sources4 archives

Databases and archives Adomerus triguttulus's data was compiled from.

GBIFGlobal Biodiversity Information Facility206 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI7 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF206 records

Environmental DNA1 datasets · 0 countries7 detections

DNA & barcodingBOLD3 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adomerus triguttulus has left across the world's sequence archives.

At a glance

DNA specimens3

BINs1

Marker genes1

eDNA detections7

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus3 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 99% of positions are identical in every specimen.

Where individuals differ — all 4 variable positions, in barcode order

89Avariable

181Avariable

415Gvariable

457Cvariable

CACCTTATATTTTATATTTGGTATATGAGCAGGAATAGTAGGAACTGCTATAAGATGAATTATCCGAATTGAATTAGGACACCCCGGAAT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.41%

Haplotypes3

BIN1

Most divergent pair0.61%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Amaurochrous dubiussame order15.1%Carbula biguttatasame order15.2%Jalla dumosasame order15.6%Palomena prasinasame order15.7%Stagonomus amoenussame order16.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type206 records

Wild obs. + sensor104

Museum / vouchered101

Other1

Range

Area of Occupancy AOO560 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 29≤1 km 7≤10 km 3>10 km 5

44 georeferenced · 60 without coordinates

Open the mapobservation + sensor104

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 6

6 georeferenced · 95 without coordinates

Open the institutions mapphysical evidence101

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Iwate Prefectural Museumlocation not on record	40
Chiba, JP	38
Sam Noble Oklahoma Museum of Natural Historylocation not on record	8
Sanda, JP	4
HUNMlocation not on record	3
KCMNlocation not on record	2
National Institute of Biological Resourceslocation not on record	1
Nagatoro-machi, Chichibu-gun, JP	1
Toyota city nature sanctuarylocation not on record	1
Bando, JP	1
Itami Shi, JP	1
NSMKlocation not on record	1

12 institutions · 101 of 101 vouchered records shown

09Environmental DNA7 detections

Where the DNA of Adomerus triguttulus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found7

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 7 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)