Adomerus biguttatus

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Cydnidae/Adomerus

At a glance

Occurrence records1 568

Data sources7

Biological traits2

DNA specimens9

eDNA detections13

Sources7 archives

Databases and archives Adomerus biguttatus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 568 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI13 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 568 records

Environmental DNA3 datasets · 3 countries13 detections

DNA & barcodingBOLD9 specimens

01Narrative

Adomerus is a monotypic genus of true bug belonging to the family Cydnidae. The only species is Adomerus biguttatus. The species was described by Carolus Linnaeus in 1758 as Cimex biguttatus. It is native to Europe and Japan. The species is said to be nationally scarce across the UK, and in April 2021 was recorded in Scotland for only the eighth time, after an absence of more than thiry years.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)herbivore

Feeding guild (larval)herbivore

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adomerus biguttatus has left across the world's sequence archives.

At a glance

DNA specimens9

BINs1

Marker genes2

eDNA detections13

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 23 variable positions, in barcode order

166Gmostly conserved

184Tmostly conserved

217Tvariable

375Cmostly conserved

412Tmostly conserved

629Gmostly conserved

633Amostly conserved

634Tmostly conserved

635Cmostly conserved

637Tmostly conserved

638Amostly conserved

639Tmostly conserved

643Amostly conserved

644Tmostly conserved

645Amostly conserved

646Tmostly conserved

647Cmostly conserved

648Amostly conserved

650Cmostly conserved

651Amostly conserved

652Tmostly conserved

655Amostly conserved

656Tmostly conserved

TACTTTATATTTTATATTTGGTATATGGGCTGGAATAGTAGGTACCGCTATAAGATGAATTATCCGTATTGAATTAGGACAACCTGGAAC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes3

BIN1

Most divergent pair0.76%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Sehirus luctuosussame family15.7%Neottiglossa flavomarginatasame order15.9%Tenosius proletariussame order16.1%Rhaphigaster nebulosasame order16.4%Bathycoelia distinctasame order16.9%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type1 568 records

Wild obs. + sensor1 133

Museum / vouchered411

Fossil10

Other14

Range

Area of Occupancy AOO4 160 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 603≤1 km 295≤10 km 151>10 km 9

1 058 georeferenced · 75 without coordinates

Open the mapobservation + sensor1 133

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy52% within 1 km

≤100 m 105≤1 km 93≤10 km 179>10 km 4

381 georeferenced · 30 without coordinates

Open the institutions mapphysical evidence411

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 21 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
NHMOlocation not on record	95
Jyväskylä, FI	46
SLU Artdatabankenlocation not on record	35
Metsähallituslocation not on record	16
Philadelphia, US	15
Tallinn, EE	12
neflocation not on record	10
ZMAAlocation not on record	9
Tromsø, NO	5
CBDClocation not on record	4
Uniwersytet Marii Curie-Skłodowskiejlocation not on record	3
Tartu, EE	3
NCMGlocation not on record	3
MZLUlocation not on record	3
Helsinki, FI	2
Kuopio, FI	2
Nagatoro-machi, Chichibu-gun, JP	2
Chiba, JP	2
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	1
Bonn, DE	1
Forssa, FI	1

21 institutions · 270 of 411 vouchered records shown · 141 without an institution code

09Environmental DNA13 detections

Where the DNA of Adomerus biguttatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found13

Studies independent surveys3

Countries3

Verifiable raw sequence linked8

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 13 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median13.7 °C 3.70–16.3

Seasonal swing summer↔winter24.1 °C

Max temp (day)17.2 °C 6.60–20.1

Min temp (night)10.3 °C -0.4–12.3

Precipitation97.5 mm/mo 39.9–101

Air humidity60.5 % 59.0–61.4

Moisture balance-6.30 mm/mo -23.3–24.3

Vapour deficit608 Pa 329–772

Wind speed2.70 m/s 2.20–2.90

Cloud cover49.9 % 46.8–53.6

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Adomerus biguttatus

At a glance

Sources7 archives

Diet & foraging2

At a glance

Record type1 568 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions11 of 21 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 568 records