Adna anglica

(Sowerby, 1823) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Maxillopoda/Sessilia/Pyrgomatidae/Adna

At a glance

Occurrence records988

Data sources8

Biological traits4

DNA specimens8

eDNA detections3

Sources8 archives

Databases and archives Adna anglica's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility523 records↗

OBISOcean Biodiversity Information System465 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics8 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources4 traits

Occurrence & distributionGBIF · OBIS988 records

Environmental DNA1 datasets · 1 countries3 detections

DNA & barcodingBOLD8 specimens

01Narrative

Adna is a genus of acorn barnacles that grows in association with or semi-parasitically on corals and octocorals. Its only species is Adna anglica. It is found in the intertidal zone on the coasts of northwestern Europe and in the Mediterranean Sea.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesSeaLifeBase

Habitat & environment2

Habitat saltwateryes

Habitat zonesessile

Other traits2

Depth max80 m

Depth min0 m

05DNA & barcoding8 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adna anglica has left across the world's sequence archives.

At a glance

DNA specimens8

BINs1

Marker genes1

eDNA detections3

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P596 bp consensus7 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 88% of positions are identical in every specimen.

Where individuals differ — all 71 variable positions, in barcode order

1Amostly conserved

2Gmostly conserved

3Tmostly conserved

7Gvariable

8Amostly conserved

9Cmostly conserved

10Amostly conserved

11Gmostly conserved

12Cmostly conserved

15Tmostly conserved

17Amostly conserved

18Gmostly conserved

20Amostly conserved

21Tmostly conserved

22Amostly conserved

23Cmostly conserved

25Tmostly conserved

26Amostly conserved

28Tmostly conserved

29Cmostly conserved

30Gmostly conserved

31Amostly conserved

32Gmostly conserved

33Cmostly conserved

34Amostly conserved

35Gmostly conserved

37Amostly conserved

39Tmostly conserved

40Amostly conserved

43Gvariable

44Cmostly conserved

46Amostly conserved

49Cmostly conserved

51Gmostly conserved

53Amostly conserved

54Gmostly conserved

55Amostly conserved

56Cmostly conserved

57Tmostly conserved

58Avariable

59Amostly conserved

61Tmostly conserved

63Gmostly conserved

64Amostly conserved

65Gmostly conserved

66Amostly conserved

67Tmostly conserved

68Gmostly conserved

69Amostly conserved

70Tmostly conserved

71Cmostly conserved

74Amostly conserved

75Tmostly conserved

76Cmostly conserved

77Tmostly conserved

78Amostly conserved

79Cmostly conserved

81Amostly conserved

82Tmostly conserved

83Gmostly conserved

94Amostly conserved

166Tvariable

235Avariable

248Cmostly conserved

292Cvariable

301Tmostly conserved

365Cmostly conserved

382Gmostly conserved

430Amostly conserved

451Cmostly conserved

580Tmostly conserved

AGTGGGGACAGCTTTAAGAATACTTATTCGAGCAGAATTAGGGCAACCCGGAAGACTAATTGGAGATGATCAAATCTACAATGTAATTGT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)3.6%

Haplotypes5

BIN1

Most divergent pair11.6%

OtherEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Nobia orbicellaesame family12.9%Nobia grandissame family13.1%Cantellius tredecimussame family13.1%Hexacreusia durhamisame order13.3%Acasta turriformissame order13.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type988 records

Wild obs. + sensor496

Museum / vouchered436

Other56

Range

Area of Occupancy AOO1 012 km²

Depth

0–200 m sunlit279

200–1000 m twilight0

1–4 km midnight0

>4 km abyssal0

median 20 m · max 80 m · 279 records with depth

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy99% within 1 km

≤100 m 409≤1 km 20≤10 km 5

434 georeferenced · 62 without coordinates

Open the mapobservation + sensor496

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 1≤1 km 2≤10 km 2>10 km 4

9 georeferenced · 427 without coordinates

Open the institutions mapphysical evidence436

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CEFASlocation not on record	11
DASSHlocation not on record	4
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
South Kensington, GB	2
Auckland, NZ	2
Marine Biological Association of the UKlocation not on record	1
Natural History Museum, Londonlocation not on record	1
Brussels, BE	1
RBINS-Scientific Heritagelocation not on record	1

9 institutions · 25 of 436 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Adna anglica was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map1 country0

Broken shellmixed shell and stone

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.8 °C 15.2–16.4

Seasonal swing summer↔winter9.40 °C

Max temp (day)17.4 °C 16.7–18.0

Min temp (night)14.1 °C 13.6–14.6

Precipitation87.4 mm/mo 81.6–93.1

Air humidity65.0 % 64.8–65.2

Vapour deficit628 Pa 607–649

Cloud cover58.1 % 56.5–59.7

CHELSA 1981–2010, ~9 km grid, at location & month of 2 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)