Adlumia fungosa

(Aiton) Greene ex Britton, Stern & Poggenb. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Ranunculales/Papaveraceae/Adlumia

At a glance

Occurrence records810

Data sources12

Biological traits11

DNA specimens7

eDNA detections4

Sources12 archives

Databases and archives Adlumia fungosa's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility810 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics7 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources11 traits

Chemical compositionLOTUS · NPASS15 compounds

Occurrence & distributionGBIF810 records

Environmental DNA1 datasets · 1 countries4 detections

DNA & barcodingBOLD · NCBI7 specimens

Genome at a glanceCCDB2n = 32

01Narrative

Adlumia fungosa, aussi appelée Adlumie fongueuse ou Cœur-saignant grimpant, est une espèce de plantes à fleurs de la famille des Papaveraceae originaire d'Amérique du Nord.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass0.08 mg

Seed mass max0.08 mg

Seed mass min0.08 mg

Life cycle & reproduction3

Life formclimbing annual or biennial

Life spanbiennial

Raunkiær life formtherophyte

Habitat & environment4

Climatetemperate

Climberobligatory

Growth formherb

⚠ sources differ — GIFT: herb · TRY: Climber

Woodinessnon-woody

Physiology & chemistry1

Photosynthetic pathwayC3

03Chemical composition15 compounds

Compounds documented for Adlumia fungosa across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Furocoumarins2

Dicarboxylic acids2

Furocoumarins $ Simple coumarins2

Isoquinoline alkaloids $ Phthalide derivatives $ Tetrahydroisoquinoline alkaloids2

Phthalide derivatives1

Documented compounds15 total

Tissue Source Quantified only

Compound	Amount	Source
(6S)-6-((1S)-1,2,3,4-Tetrahydro-6,7-dimethoxy-2-methyl-1-isoquinolinyl)furo(3,4-e)-1,3-benzodioxol-8(6H)-one	present	LOTUS
(6S)-6-((5S)-5,6,7,8-Tetrahydro-6-methyl-1,3-dioxolo(4,5-g)isoquinolin-5-yl)furo(3,4-e)-1,3-benzodioxol-8(6H)-one	present	LOTUS
2-Butenedioic acid	present	LOTUS
9-[(2S)-2,3-dihydroxy-3-methylbutoxy]-4-methoxyfuro[3,2-g]chromen-7-one	present	NPASS
[(3S)-5-hydroxy-2,2-dimethyl-8-[[(Z)-2-methylbut-2-enoyl]oxymethyl]-6-oxo-3,4-dihydropyrano[3,2-g]chromen-3-yl] (2S,3S)-2,3-dimethyloxirane-2-carboxylate	present	NPASS
Bergapten	present	NPASS
Bicuculline	present	LOTUS
Bisabolangelone	present	NPASS
BJTCLTIDRHFSRO-GKTHTKQVSA-N	present	NPASS
fumarate	present	LOTUS

05DNA & barcoding7 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adlumia fungosa has left across the world's sequence archives.

At a glance

DNA specimens7

Marker genes5

GenBank sequences10

eDNA detections4

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMG235713.1 ↗234 bpCanada · 2012

ACGT

CGCCTAGGCCGTGGGAGCGGACAATGGCCCCCCGTGCCCCCCCGCGCGGCTGGCTTAAAAGAAGGCCCTGGGAGGCCGGCGTCACGATCC …

Adlumia fungosa voucher MT00179366 internal transcribed spacer 2 and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK4★rbcL4★rbcLa★ITS2★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Adlumia fungosa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 32 n = 16

Ploidypolyploid inferred

Chromosome records32–322n range32median32mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 326×CCDB · ipcn-api-dl · CCDB · eflora · CCDB · book-fedorov

CCDB · ipcn-api-dl — Löve, A. & D. Löve. 1982. In: IOPB chromosome number reports LXXIV. Taxon 31: 120–126.

CCDB · ipcn-api-dl — Lidén, M. 1986. Synopsis of Fumarioideae (Papaveraceae) with a monograph of the tribe Fumariaeae. Opera Bot. 88: 1–133.

CCDB · eflora

CCDB · book-fedorov — Smith E.. (T. 19351936)

CCDB · book-fedorov — Negodi 1940 (D. 1955)

CCDB · book-fedorov — Ryberg 1960

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

polyploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type810 records

Wild obs. + sensor376

Museum / vouchered434

Origin

Introduced1

Range

Area of Occupancy AOO2 364 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy48% within 1 km

≤100 m 117≤1 km 36≤10 km 15>10 km 153

321 georeferenced · 55 without coordinates

Open the mapobservation + sensor376

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy22% within 1 km

≤100 m 14≤1 km 61≤10 km 248>10 km 24

347 georeferenced · 87 without coordinates

Open the institutions mapphysical evidence434

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions38 of 53 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Philadelphia, US	75
Chongqing Museumlocation not on record	71
Burlington, US	35
New Haven, US	29
Allentown, US	19
Montréal, CA	16
Madison, US	16
Chapel Hill, US	13
Philadelphia, US	8
Bloomington, US	8
Green Bay, US	7
Québec, CA	7
LDlocation not on record	7
SLU Artdatabankenlocation not on record	7
Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record	5
Millersville, US	4
Vancouver, CA	4
Acadia Universitylocation not on record	4
Tampa, US	4
Williamsburg, US	3
University of Alberta Museumslocation not on record	3
Institut und Museum fuer Geologie und Palaeontologielocation not on record	3
Auckland, NZ	3
Durham, US	3
Staten Island, US	3
Mohonk Preservelocation not on record	3
Toronto, CA	2
Chicago, US	2
Norfolk, US	2
Morgantown, US	2
Bronx, US	2
Keene State Universitylocation not on record	2
Saint John, CA	2
Oskarshamn, SE	2
Riverside, US	1
Université Lavallocation not on record	1
WINlocation not on record	1
DOI/NPS, Greenbelt Parklocation not on record	1
Flagstaff, US	1
Elikins, US	1
Universite de Montreal, L'Herbier Marie-Victorinlocation not on record	1
McGill University, Herbariumlocation not on record	1
Moscow, US	1
Paris, FR	1
Mexico City, MX	1
Denver, US	1
Helsinki, FI	1
Columbia, US	1
Emporia, US	1
Research Collection of B. A. Bennettlocation not on record	1
Beijing, CN	1
Whitehorse, CA	1
Bangkok, TH	1

53 institutions · 395 of 434 vouchered records shown · 39 without an institution code

09Environmental DNA4 detections

Where the DNA of Adlumia fungosa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map1 country0

disturbed area in alvar woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median19.0 °C 9.80–19.5

Seasonal swing summer↔winter30.4 °C

Max temp (day)23.7 °C 14.5–24.2

Min temp (night)14.2 °C 6.90–15.5

Precipitation97.3 mm/mo 87.1–103

Air humidity59.7 % 57.1–61.7

Moisture balance-28.2 mm/mo -38.9–27.7

Vapour deficit924 Pa 499–950

Wind speed2.70 m/s 2.70–3.20

Cloud cover49.0 % 47.6–55.8

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)