Adisura marginalis

Walker, 1858 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Noctuidae/Adisura

At a glance

Occurrence records467

Data sources7

Biological traits0

DNA specimens18

eDNA detections1

Sources7 archives

Databases and archives Adisura marginalis's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility467 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF467 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD18 specimens

01Narrative

Adisura marginalis (new pod borer) is a species of moth of the family Noctuidae. It is found in Myanmar, India, Malaysia, the Philippines, Thailand, Vietnam and Indonesia, as well as the Northern Territory, Queensland and Western Australia in Australia. The larvae feed on Cajanus cajan.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adisura marginalis has left across the world's sequence archives.

At a glance

DNA specimens18

BINs1

Marker genes1

eDNA detections1

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus17 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.06%

Haplotypes2

BIN1

Most divergent pair0.15%

Where individuals differ — all 2 variable positions, in barcode order

118Cmostly conserved

631Gmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACCTCATTAAGATTATTAATTCGAGCCGAATTAGGTAATCCCGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adisura callimasame genus7.2%Heliocheilus paradoxussame family7.3%Adisura bellasame genus7.4%Heliocheilus ranalaetensissame family7.4%Heliocheilus confertissimasame family7.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type467 records

Wild obs. + sensor175

Museum / vouchered292

Range

Area of Occupancy AOO724 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 56≤1 km 85≤10 km 8>10 km 7

156 georeferenced · 19 without coordinates

Open the mapobservation + sensor175

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy30% within 1 km

≤100 m 31≤1 km 46≤10 km 166>10 km 15

258 georeferenced · 34 without coordinates

Open the institutions mapphysical evidence292

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Australian National Fish Collectionlocation not on record	257
Helsinki, FI	14
Museums Victorialocation not on record	10
Tallinn, EE	4
National Museums of Kenyalocation not on record	1

5 institutions · 286 of 292 vouchered records shown · 6 without an institution code

09Environmental DNA1 detections

Where the DNA of Adisura marginalis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)