Adicella reducta

(McLachlan, 1865) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Trichoptera/Leptoceridae/Adicella

At a glance

Occurrence records1 819

Data sources7

Biological traits2

DNA specimens45

eDNA detections32

Sources7 archives

Databases and archives Adicella reducta's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 819 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI32 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics45 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources2 traits

Occurrence & distributionGBIF1 819 records

Environmental DNA1 datasets · 5 countries32 detections

DNA & barcodingBOLD45 specimens

Genome at a glanceGoaT · NCBI≈415 Mbp

01Narrative

Adicella reducta is een schietmot uit de familie Leptoceridae. De soort komt voor in het Palearctisch gebied.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesPantheon

Diet & foraging2

Feeding guild (adult)possible nectivore

Feeding guild (larval)omnivore

05DNA & barcoding45 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adicella reducta has left across the world's sequence archives.

At a glance

DNA specimens45

BINs3

Marker genes3

eDNA detections32

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus36 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 31 variable positions, in barcode order

4Amostly conserved

5Cmostly conserved

23Amostly conserved

25Amostly conserved

29Gmostly conserved

31Avariable

40Gvariable

43Gvariable

73Amostly conserved

112Tmostly conserved

166Amostly conserved

169Gmostly conserved

197Tmostly conserved

212Tmostly conserved

220Tvariable

268Avariable

278Tvariable

319Tmostly conserved

340Tmostly conserved

346Cmostly conserved

349Gmostly conserved

355Amostly conserved

361Tmostly conserved

388Amostly conserved

478Amostly conserved

517Tvariable

556Gvariable

586Tmostly conserved

601Cvariable

616Cmostly conserved

625Avariable

AACACTATATTTTATTTTTGGAATATGAGCAGGACTATTGGGGACTTCCCTAAGTGTTTTAATTCGAACTGAACTAGGTATAACAGGAGC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.4%

Haplotypes16

BINs2

Most divergent pair18.5%

EuropeOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adicella filicornissame genus10.3%Adicella hakkariensissame genus13.4%Triaenodes ochraceussame family15.2%Oecetis disjunctasame family15.2%Triaenodes dipsiussame family16.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18SWnt1

animal barcoderibosomalmarker

06Genome at a glanceGoaT · NCBI

The complete instruction manual Adicella reducta carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈414 849 825 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Adicella reducta0.41 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

Completeness98.8% BUSCO

08Occurrence & distribution

Record type1 819 records

Wild obs. + sensor1 152

Museum / vouchered461

Other206

Origin

Native13

Range

Area of Occupancy AOO3 880 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy65% within 1 km

≤100 m 512≤1 km 40≤10 km 291>10 km 1

844 georeferenced · 308 without coordinates

Open the mapobservation + sensor1 152

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 91≤1 km 96≤10 km 51>10 km 1

239 georeferenced · 222 without coordinates

Open the institutions mapphysical evidence461

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 23 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UMUlocation not on record	181
Natural History Museum Rotterdamlocation not on record	58
Provincia di Livornolocation not on record	58
SLU Artdatabankenlocation not on record	33
UGRlocation not on record	28
Zürich, CH	19
CIBIOlocation not on record	9
St. Paul, US	6
Naturéum — Muséum cantonal des sciences naturelles, Lausanne, Département Zoologielocation not on record	5
NHMOlocation not on record	5
South Kensington, GB	4
Paro, BT	4
Frankfurt am Main	3
ZSMlocation not on record	3
Natural History Museum, Londonlocation not on record	2
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	2
Stockholm, SE	2
Musee cantonal de zoologie de Lausannelocation not on record	1
Montréal, CA	1
BioFokuslocation not on record	1
DFlocation not on record	1
NTNU-VMlocation not on record	1
University of Kaiserslauternlocation not on record	1

23 institutions · 428 of 461 vouchered records shown · 33 without an institution code

09Environmental DNA32 detections

Where the DNA of Adicella reducta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found32

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 32 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.4 °C 9.40–17.8

Seasonal swing summer↔winter16.1 °C

Max temp (day)18.4 °C 13.5–22.1

Min temp (night)10.8 °C 4.40–13.1

Precipitation73.7 mm/mo 44.8–95.0

Air humidity60.1 % 57.1–64.5

Moisture balance-43.6 mm/mo -76.9–-4.70

Vapour deficit646 Pa 492–808

Wind speed3.30 m/s 2.30–4.20

Cloud cover38.5 % 34.1–42.2

CHELSA 1981–2010, ~9 km grid, at location & month of 29 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Adicella reducta

At a glance

Sources7 archives

Diet & foraging2

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

Record type1 819 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 23 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 819 records