Adiantum pedatum
speciesAt a glance
Occurrence records31 267
Data sources13
Biological traits100
DNA specimens31
eDNA detections29
Sources13 archives
Databases and archives Adiantum pedatum's data was compiled from.
BioWikiNetmultilingual Wikipediamultilingual↗
GBIFGlobal Biodiversity Information Facility31 267 records↗
ENAEuropean Nucleotide Archive · EMBL-EBI29 eDNA detections↗
BOLD SystemsCentre for Biodiversity Genomics31 specimens↗
NCBIUS National Library of Medicinesequences↗
LOTUSNatural Products (Wikidata)compounds↗
NPASSNat. Product Activity & Species Sourcecompounds↗
GRIN TaxonomyUSDA-ARSdistribution & uses↗
Open Tree of LifeOpenTreephylogeny backbone↗
CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗
giftgenome & karyotype
GoaTGenomes on a Tree · Sangergenome & karyotype↗
Paleobiology DatabasePBDB consortiumfossil record↗On this page7 sections
Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.
NarrativeWikipediaarticle
Traits & measurements4 literature sources100 traits
Chemical compositionLOTUS · NPASS51 compounds
Occurrence & distributionGBIF31 267 records
Environmental DNA1 datasets · 4 countries29 detections
DNA & barcodingBOLD · NCBI31 specimens
Genome at a glanceCCDB · GoaT5.2 Gbp
01Narrative
Adiantum pedatum, aussi appelée Adiante du Canada, Fougère du Canada, Capillaire du Canada ou Adiante pédalée, est une espèce de fougère de la famille des Pteridaceae. Elle est considérée comme la plus belle fougère du Canada, c'est ainsi que dans son Manuel de Floriculture, Phillippe de Vilmorin évoque “sa parfaite rusticité et sa grande élégance”. Elle est originaire des zones tempérées de l'Asie du Sud-Est et de l'Amérique du Nord.
No narrative description available for this taxon yet.
02Traits & measurements
SourcesWCVPGIFTUSDATRY
Size & morphology4
Leaf size108 mm²
Plant height0.4 m
⚠ sources differ — GIFT: 0.4 m · USDA: 0.396 m · TRY: 0.339 m
Plant height max0.4 m
Plant height min0.2 m
Life cycle & reproduction28
After harvest regrowth rateSlow
Bloom periodSummer
Coppice potentialNo
DeciduousnessN
Flower colourbrown
Flower conspicuousNo
Flowering endAug
Flowering startJul
Fruit seed period beginSummer
Fruit seed period endFall
Growth rate USDAModerate
Life formperennial or rhizomatous geophyte
Life spanperennial
Lifespan categoryModerate
Propagated by bare rootNo
Propagated by bulbNo
Propagated by containerYes
Propagated by cormNo
Propagated by cuttingsNo
Propagated by seedNo
Propagated by sodNo
Propagated by sprigsYes
Propagated by tubersNo
Raunkiær life formchamaephyte
Resprout abilityNo
Seed spread rateSlow
Seedling vigorLow
Vegetative spread rateModerate
Diet & foraging1
Parasiteindependent
Habitat & environment26
Active growth periodSpring and Summer
Adapted to coarse textured soilsYes
Adapted to fine textured soilsNo
Adapted to medium textured soilsYes
Aquaticterrestrial
BloatNone
Climatetemperate
Climberself-supporting
Epiphyteterrestrial
Foliage colorDark Green
Foliage porosity summerModerate
Foliage porosity winterPorous
Foliage textureFine
Fruit colourbrown
Growth formherb
⚠ sources differ — GIFT: herb · TRY: F
Growth form USDARhizomatous
Habitat GIFTforest
Hedge toleranceNone
Known allelopathNo
Leaf retentionNo
Low growing grassNo
Mycorrhiza typearbuscular
Root depth min10 in
Shape and orientationSemi-Erect
Small grainNo
Woodinessnon-woody
Physiology & chemistry23
Anaerobic toleranceLow
C:N ratioMedium
Caco3 toleranceLow
Cold stratification requiredNo
Drought toleranceLow
Fertility requirementHigh
Fire resistantNo
Fire toleranceMedium
Frost free days min80 days
Leaf c467 mg/g
Leaf dry-matter content (LDMC)311 mg/g
Leaf n30.31 mg/g
Moisture useMedium
Nitrogen fixation levelNone
Photosynthetic pathwayC3
Precipitation max60 in
Precipitation min36 in
Salinity toleranceNone
Shade toleranceLow
Soil pH max6.6 pH
Soil pH min4.6 pH
Specific leaf area (SLA)49.4 mm²/mg
Temperature min-38 °F
Uses & economy12
Berry nut seed productNo
Christmas tree productNo
Commercial availabilityContracting Only
Fodder productNo
Lumber productNo
Naval store productNo
Nursery stock productYes
Palatable humanNo
Post productNo
Pulpwood productNo
ToxicityNone
Veneer productNo
Other traits6
Fall conspicuousYes
Fruit seed abundanceHigh
Fruit seed conspicuousNo
Fruit seed persistenceNo
Planting density max4 800 per acre
Planting density min1 200 per acre
03Chemical composition51 compounds
Compounds documented for Adiantum pedatum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").
Compound class profile5 classes
Hopane and Moretane triterpenoids12
Fernane and Arborinane triterpenoids8
Carotenoids (C40, β-β)3
Hopane and Moretane triterpenoids $ Neohopane triterpenoids3
Carotenoids (C40, β-ε)2
Documented compounds51 total
| Compound | Class | Amount | Source |
|---|---|---|---|
| (3R,3'R,13-cis)-beta,beta-Carotene-3,3'-diol | present | LOTUS | |
| (3R,3aR,5aR,5bR,7aS,11aS,11bR,13aS,13bR)-3a,5a,7a,11b,13a-pentamethyl-3-propan-2-yl-1,2,3,4,5,5b,6,7,10,11,11a,12,13,13b-tetradecahydrocyclopenta[a]chrysene-8-carboxylic acid | present | LOTUS | |
| (3R,3aR,5aR,5bS,7aS,11aS,11bR,13aS,13bR)-3a,5a,7a,11b,13a-pentamethyl-3-propan-2-yl-1,2,3,4,5,5b,6,7,10,11,11a,12,13,13b-tetradecahydrocyclopenta[a]chrysene-8-carbaldehyde | present | LOTUS | |
| (3R,3aR,5aS,5bR,7aS,11aS,11bR)-3a,5a,5b,8,8,11a-hexamethyl-3-propan-2-yl-1,2,3,4,5,6,7,7a,9,10,11,11b-dodecahydrocyclopenta[a]chrysene | present | LOTUS | |
| (3R,3aR,5aS,7aS,11aS,11bR,13aS,13bR)-3a,5a,8,8,11a,13a-hexamethyl-3-propan-2-yl-1,2,3,4,5,7,7a,9,10,11,11b,12,13,13b-tetradecahydrocyclopenta[a]chrysene | present | LOTUS | |
| (3R,3aR,5aS,7aS,11aS,13aS,13bR)-3a,5a,8,8,11a,13a-hexamethyl-3-propan-2-yl-1,2,3,4,5,7,7a,9,10,11,13,13b-dodecahydrocyclopenta[a]chrysene | present | LOTUS | |
| (4S,4aR,6aR,6aR,6bR,8aR,12aS,14aR,14bR)-4-hydroxy-4,6a,6b,9,9,12a,14b-heptamethyl-2,4a,5,6,6a,7,8,8a,10,11,12,13,14,14a-tetradecahydro-1H-picen-3-one | present | LOTUS | |
| (8alpha,13alpha,14beta,17alpha,18beta)-13,17-Dimethyl-A'-neo-26,28-dinorgammacer-9(11)-ene | present | LOTUS | |
| 1-[(3R,3aR,5aR,5bR,7aS,11aS,11bR,13aR,13bR)-3-hydroxy-5a,5b,8,8,11a,13b-hexamethyl-2,3a,4,5,6,7,7a,9,10,11,11b,12,13,13a-tetradecahydro-1H-cyclopenta[a]chrysen-3-yl]ethanone | present | LOTUS | |
| 1-[(3R,3aR,5aR,5bR,7aS,11aS,11bR,13aS,13bR)-3-hydroxy-5a,5b,8,8,11a,13b-hexamethyl-2,3a,4,5,6,7,7a,9,10,11,11b,12,13,13a-tetradecahydro-1H-cyclopenta[a]chrysen-3-yl]ethanone | present | LOTUS |
05DNA & barcoding31 specimens
A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adiantum pedatum has left across the world's sequence archives.
At a glance
DNA specimens31
Marker genes3
GenBank sequences10
eDNA detections29
Countries4
The DNA barcodea real sequence read deposited for this species
AGGTGTTGGATTCAAAGCTGGTGTCAAAGATTACCGATTGACCTATTACACTCCCGAATACAAGACCAAAGACACTGATATCTTAGCGGC …
Adiantum pedatum voucher SCBI-SIGEO_13_0505 ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; chloroplast
Marker genes sequenced
★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.
★rbcL10★rbcLatrnH-psbA
plant barcodemarker
06Genome at a glanceCCDB · GoaT
The complete instruction manual Adiantum pedatum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.
Genome sizehow big the whole instruction manual is
Genome size5 166 285 000 bp
Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).
BACTERIUM Carsonella ruddii0.00016 Gb
FUNGUS0.04 Gb
INSECT0.25 Gb
HUMAN3.2 Gb
THIS GENOME Adiantum pedatum5.17 Gb
WHEAT17 Gb
FERN Tmesipteris160.45 Gb
Chromosomes & ploidyhow the DNA is packaged
2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.
Chromosomes2n = 58 n = 29
Ploidy2× diploid · measured
Chromosome records58–582n range58median58mode3records
Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references
2n 583×GoaT · Kew Plant DNA C-values Database · CCDB · ipcn-api-dl · CCDB · eflora
GoaT · Kew Plant DNA C-values Database — ↗
CCDB · ipcn-api-dl — Love, A. & D. Love. 1976. In IOPB chromosome number reports LIII. Taxon 25: 483–500.
CCDB · eflora
n 295×CCDB · ipcn-api-dl · CCDB · book-ipcn67-71 · CCDB · Cave1956supp +1
CCDB · ipcn-api-dl — Paris, C. A. 1986. In: C. H. Haufler & D. E. Soltis, Genetic evidence suggests that homosporous ferns with high chromosome numbers are diploid. Proc. Natl. Acad. Sci. U.S.A. 83: 4389–4393.
CCDB · book-ipcn67-71 — MITUI, K. 1968. Chromosomes and speciation in ferns. Sci. Rep. Tokyo Kyoiku Daigaku Sect. B 13: 285-333.
CCDB · Cave1956supp — Britton 1953
CCDB · Cave1956supp — Manton & Sledge 1954
CCDB · Cave1963 — Wagner in Fabbri 1963
n 302×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78
CCDB · ipcn-api-dl — Mitui, K. 1976. Chromosome studies on Japanese ferns (5). Bull. Nippon Dental Univ., Gen. Educ. 5: 133–140.
CCDB · book-ipcn75-78 — Mitui 1976
n 221×CCDB · book-ipcn72
CCDB · book-ipcn72 — GOMEZ-PIGNATARO, L.D. 1971. Ricerche citologiche sulle Pteridof ite della Costa Rica. 1. Atti Ist. Bot. Univ. Lab. Crittogam. Pavia (Ser. 6.) 7: 29-31.
Ploidy records — measured levels and diploid/polyploid inferences · click for sources
diploid2×GoaT · Kew Plant DNA C-values Database · GIFT · GIFT (floras)
GoaT · Kew Plant DNA C-values Database
GIFT · GIFT (floras)
08Occurrence & distribution
Record type31 267 records
Wild obs. + sensor21 395
Museum / vouchered9 861
Cultivated / captive9
Other2
Origin
Native6
Range
Area of Occupancy AOO68 968 km²
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
Coordinate accuracy79% within 1 km
≤100 m 11 038≤1 km 2 596≤10 km 1 476>10 km 2 183
17 293 georeferenced · 4 102 without coordinates
Open the mapobservation + sensor21 395
Museum / Voucheredphysical evidence
Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.
Coordinate accuracy31% within 1 km
≤100 m 156≤1 km 1 020≤10 km 2 287>10 km 308
3 771 georeferenced · 6 090 without coordinates
Open the institutions mapphysical evidence9 861
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
Coordinate accuracy100% within 1 km
≤100 m 1≤1 km 2
3 georeferenced · 6 without coordinates
Open the mapnot free-living9
Wildobservation + sensor
Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.
10Collections & institutions
Holding institutions161 of 261 geolocated
Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.
| Institution | Specimens |
|---|---|
| Tsukuba, JP | 2 520 |
| Philadelphia, US | 633 |
| Madison, US | 402 |
| Chongqing Museumlocation not on record | 380 |
| St. Paul, US | 310 |
| Bronx, US | 189 |
| Odawara, JP | 178 |
| Beijing, CN | 174 |
| Knoxville, US | 169 |
| Chicago, US | 169 |
| Chapel Hill, US | 166 |
| Ann Arbor, US | 160 |
| Minia, EG | 151 |
| Toyama, JP | 146 |
| Wuzhou, CN | 143 |
| Sanda, JP | 136 |
| Yangling, CN | 125 |
| Shinshu Universitylocation not on record | 120 |
| McWane Science Centerlocation not on record | 119 |
| Burlington, US | 111 |
| Bloomington, US | 111 |
| Québec, CA | 104 |
| Osaka, JP | 102 |
| University of New Hampshirelocation not on record | 90 |
| Bando, JP | 84 |
| Nagano City, JP | 84 |
| Université Lavallocation not on record | 74 |
| Chengdu, CN | 74 |
| Moscow State Universitylocation not on record | 67 |
| Green Bay, US | 59 |
| Museo civico La Terra e l'Uomo di Crocetta del Montellolocation not on record | 56 |
| Tomioka, JP | 54 |
| Moscow, US | 54 |
| New Haven, US | 54 |
| WTUlocation not on record | 53 |
| Bangkok, TH | 50 |
| DOI/NPS, Mississippi National River & Recreation Arealocation not on record | 48 |
| Williamsburg, US | 48 |
| Toronto, CA | 46 |
| Montréal, CA | 42 |
| Flagstaff, US | 42 |
| Saint John, CA | 41 |
| Sendai, JP | 38 |
| Durham, US | 38 |
| University of Stellenboschlocation not on record | 37 |
| LDlocation not on record | 36 |
| College Park, US | 34 |
| Morgantown, US | 34 |
| Vancouver, CA | 33 |
| South Kensington, GB | 32 |
| Tuscaloosa, US | 31 |
| Allentown, US | 31 |
| Wuhan, CN | 30 |
| Columbia, US | 27 |
| KOMlocation not on record | 26 |
| Jackson, US | 25 |
| KURAlocation not on record | 24 |
| Tampa, US | 23 |
| Saint Louis, US | 22 |
| Xian, CN | 21 |
| Sugadaira Research Station, Mountain Science Center, University of Tsukubalocation not on record | 21 |
| Fort Worth, US | 21 |
| Mississippi State, US | 19 |
| JP | 19 |
| Nanjing, CN | 18 |
| Acadia Universitylocation not on record | 18 |
| Millersville, US | 18 |
| Kushiro City Museumlocation not on record | 18 |
| Otaru, JP | 17 |
| University of Tennessee at Chattanoogalocation not on record | 16 |
| Iwate Prefectural Museumlocation not on record | 15 |
| Auckland, NZ | 15 |
| Pullman, US | 15 |
| Davenport, US | 15 |
| Fukushima Universitylocation not on record | 15 |
| Philadelphia, US | 15 |
| Dekalb, US | 15 |
| Nanchong, CN | 14 |
| Xining, CN | 13 |
| Trois-Rivières, CA | 13 |
| Nishihara, JP | 13 |
| Sagamihara, JP | 13 |
| Western Carolina Universitylocation not on record | 13 |
| Servico de Microbiologia e Imunologialocation not on record | 12 |
| Keene State Universitylocation not on record | 12 |
| New Brunswick, US | 12 |
| US | 12 |
| Victoria, CA | 11 |
| Chengdu, CN | 11 |
| Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record | 11 |
| Waverly, US | 11 |
| Chicago, US | 10 |
| Whitewater, US | 10 |
| WNNUlocation not on record | 10 |
| Austin, US | 10 |
| GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record | 9 |
| Brookings, US | 9 |
| Edinburgh, GB | 9 |
| Staten Island, US | 9 |
| Clemson, US | 9 |
| KIRMlocation not on record | 9 |
| Boise, US | 8 |
| Wellington, NZ | 8 |
| Paris, FR | 8 |
| Herbarium of the Department of Botany, University of Tokyolocation not on record | 8 |
| Portland, US | 8 |
| GAlocation not on record | 8 |
| University of Alberta Museumslocation not on record | 8 |
| US | 7 |
| Obihiro Centennial City Museumlocation not on record | 7 |
| Kingston, US | 7 |
| Zhengzhou, CN | 7 |
| Guangzhou, CN | 7 |
| San Luis Obispo, US | 7 |
| Russellville, US | 7 |
| Kyoto Universitylocation not on record | 7 |
| James F. Matthews Center for Biodiversity Studieslocation not on record | 6 |
| Hamilton, US | 6 |
| Richmond, US | 6 |
| Denver, US | 6 |
| Durham, US | 6 |
| SLU Artdatabankenlocation not on record | 6 |
| Angwin, US | 6 |
| Wuhan, CN | 6 |
| Montréal, CA | 6 |
| Ishikawa Museum of Natural Historylocation not on record | 6 |
| KR | 5 |
| Asheville, US | 5 |
| ASUlocation not on record | 5 |
| Claremont, US | 5 |
| US | 5 |
| Seoul, KR | 5 |
| Provo, US | 5 |
| Toyota city nature sanctuarylocation not on record | 5 |
| University of Calgarylocation not on record | 5 |
| Fairfax, US | 5 |
| Pacific Lutheran Universitylocation not on record | 5 |
| Mohonk Preservelocation not on record | 5 |
| National Institute of Biological Resourceslocation not on record | 4 |
| Santa Barbara, US | 4 |
| Museum of the Rockieslocation not on record | 4 |
| Chadron, US | 4 |
| San Angelo, US | 4 |
| Norfolk, US | 4 |
| BAYLUlocation not on record | 4 |
| Bend, US | 4 |
| Omachi Alpine Museumlocation not on record | 4 |
| GB | 4 |
| Tennessee Technological Universitylocation not on record | 3 |
| Macomb, US | 3 |
| Johnson City, US | 3 |
| GMBAlocation not on record | 3 |
| Taipei, TW | 3 |
| Riverside, US | 3 |
| Washington, US | 3 |
| Muzaffarabad, PK | 3 |
| Tianjin Natural History Museumlocation not on record | 3 |
| University of Lethbridgelocation not on record | 3 |
| Meguro Parasitological Museumlocation not on record | 3 |
| Phoenix, US | 3 |
| Peking Universitylocation not on record | 3 |
| San Jose State University, Museum of Birds and Mammalslocation not on record | 3 |
| Beijing Normal Universitylocation not on record | 3 |
| Taipei, TW | 3 |
| Smithsonian Institutionlocation not on record | 2 |
| Dresden, DE | 2 |
| Cheney, US | 2 |
| Pocatello, US | 2 |
| Istituto Agrario Castelnuovolocation not on record | 2 |
| Anchorage, US | 2 |
| Tacoma, US | 2 |
| Görlitz, DE | 2 |
| Logan, US | 2 |
| AUAlocation not on record | 2 |
| Corvallis, US | 2 |
| San Diego, US | 2 |
| Royal Ontario Museum, Green Plant Herbarium (TRT)location not on record | 2 |
| Chengdu, CN | 2 |
| Lanzhou, CN | 2 |
| Culiacán, MX | 2 |
| CASlocation not on record | 2 |
| Sapporo, JP | 2 |
| Kunming, CN | 2 |
| Tartu, EE | 2 |
| Albuquerque, US | 2 |
| SEINetlocation not on record | 2 |
| DOI/NPS, Little Rock Central High School National Historic Sitelocation not on record | 2 |
| Conway, US | 2 |
| Chicago, US | 2 |
| Pittsburg, US | 2 |
| Little Rock, US | 2 |
| MeiseBGlocation not on record | 2 |
| Yunnan Universitylocation not on record | 2 |
| Chiba, JP | 2 |
| Central China Normal Universitylocation not on record | 2 |
| J.F.Oberlin Universitylocation not on record | 2 |
| US | 2 |
| Tempe, US | 2 |
| University of Wisconsinlocation not on record | 2 |
| Durango, US | 2 |
| Hokkaido University Museumlocation not on record | 2 |
| Edmonton, CA | 1 |
| Adam Mickiewicz University in Poznańlocation not on record | 1 |
| BMlocation not on record | 1 |
| Parthenon Tama History Museumlocation not on record | 1 |
| Jiangxi Universitylocation not on record | 1 |
| Institute of Applied Ecology, Academia Sinicalocation not on record | 1 |
| Fredericton Stock Culture Collectionlocation not on record | 1 |
| Musee des Dinosaures d'Esperaza (Aude)location not on record | 1 |
| Tilburg, NL | 1 |
| Guilin, CN | 1 |
| Fargo, US | 1 |
| Maryland Department of Natural Resourceslocation not on record | 1 |
| Canadian Department of Agriculturelocation not on record | 1 |
| Long Beach, US | 1 |
| KNFHClocation not on record | 1 |
| USFSlocation not on record | 1 |
| Guiyang, CN | 1 |
| Bozeman, US | 1 |
| Fayetteville, US | 1 |
| Turku, FI | 1 |
| Cincinnati, US | 1 |
| University of Guelph, OAC Herbariumlocation not on record | 1 |
| Cambridge, US | 1 |
| Podgorica, ME | 1 |
| Jena Microbial Resource Collectionlocation not on record | 1 |
| McGill University, Herbariumlocation not on record | 1 |
| Akita Prefectural Museumlocation not on record | 1 |
| University of South Carolina Salkehatchielocation not on record | 1 |
| Universite de Montreal, L'Herbier Marie-Victorinlocation not on record | 1 |
| PHlocation not on record | 1 |
| Kochi, JP | 1 |
| EL PASO, US | 1 |
| Valdosta State Universitylocation not on record | 1 |
| Uppsala, SE | 1 |
| Oskarshamn, SE | 1 |
| Tampere, FI | 1 |
| China Agricultural Universitylocation not on record | 1 |
| Vanderbilt Universitylocation not on record | 1 |
| Institut und Museum fuer Geologie und Palaeontologielocation not on record | 1 |
| Decorah, US | 1 |
| BRNUlocation not on record | 1 |
| Missoula, US | 1 |
| Córdoba, AR | 1 |
| University of North Carolina at Pembrokelocation not on record | 1 |
| Ischia Marine Centrelocation not on record | 1 |
| ENHMlocation not on record | 1 |
| Lord Fairfax Community Collegelocation not on record | 1 |
| IWEP FEB RASlocation not on record | 1 |
| Black Rock Forest Consortiumlocation not on record | 1 |
| STUlocation not on record | 1 |
| Oiso Municipal Museumlocation not on record | 1 |
| Kawasaki Shi Tama Ku, JP | 1 |
| Tulane Universitylocation not on record | 1 |
| Santa Cruz, US | 1 |
| Kiritappu Wetland National Trustlocation not on record | 1 |
| Bern, CH | 1 |
| DULlocation not on record | 1 |
| Trondheim, NO | 1 |
| JMSlocation not on record | 1 |
| ISAlocation not on record | 1 |
261 institutions · 9 489 of 9 861 vouchered records shown · 368 without an institution code
Cultivated / Captivenot free-living
A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.
09Environmental DNA29 detections
Where the DNA of Adiantum pedatum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.
Signal
Detections DNA found29
Studies independent surveys1
Countries4
Signal confidence: weakweighed across independent studies, places & mapped detections
Where its DNA was found
0 of 29 detections have coordinates
Open the map4 countries0
Roadside; dense deciduous woodland; over lim…Coniferous forest.
How strong is each trace?
DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.
Modelled climatemodelled
−15°Ctemperature across detection sites+40°C
Temperature median15.5 °C 7.70–23.2
Seasonal swing summer↔winter27.2 °C
Max temp (day)20.6 °C 10.2–28.5
Min temp (night)12.2 °C 3.00–17.9
Precipitation101 mm/mo 79.8–321
Air humidity56.9 % 55.4–64.7
Moisture balance-46.2 mm/mo -57.1–240
Vapour deficit820 Pa 443–1,238
Wind speed2.90 m/s 2.40–4.40
Cloud cover41.7 % 31.5–49.5
CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche
How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.