Adiantum atroviride

Bostock · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Polypodiopsida/Polypodiales/Pteridaceae/Adiantum

At a glance

Occurrence records1 024

Data sources4

Biological traits17

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Adiantum atroviride's data was compiled from.

GBIFGlobal Biodiversity Information Facility1 024 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Traits & measurements2 literature sources17 traits

Occurrence & distributionGBIF1 024 records

DNA & barcodingNCBIsequences

Genome at a glanceCCDB2n = 114

02Traits & measurements

SourcesAusTraitsGIFT

Size & morphology3

Leaf length67 mm

Leaf length max750 mm

Leaf width47 mm

Life cycle & reproduction4

Dispersal typewind

Life spanperennial

Pollination syndromeabiotic

Resprouting capacityresprouts

Diet & foraging1

Parasiteindependent

Habitat & environment7

Aquaticterrestrial

Climberself-supporting

Epiphyteterrestrial

Growth formfern

Leaf compoundnesscompound

Leaf shapeovate triangular

Woodinessnon-woody

Physiology & chemistry2

Nitrogen fixingnon_nitrogen_fixer

Photosynthetic pathwayC3

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adiantum atroviride has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

rbcLMH019541.1 ↗1 309 bpAustralia

ACGT

AGGTGTTGGATTCAAAGCTGGTGTCAAAGATTATCGATTGACCTATTACACTCCCGAATACGTGACCAAAGACACTGATATCTTAGCGGC …

Adiantum atroviride ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit (rbcL) gene, partial cds; plastid

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL1

plant barcode

06Genome at a glanceCCDB

The complete instruction manual Adiantum atroviride carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 114 n = 57

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

n 572×CCDB · barker-ferns · CCDB · ipcn-api-dl

CCDB · barker-ferns — Tindale, Mary D., and S. K. Roy. "A cytotaxonomic survey of the Pteridophyta of Australia."Australian Systematic Botany15.6 (2002): 839-937.

CCDB · ipcn-api-dl — Tindale. 2002. In M. D. Tindale & S. K. Roy, A cytotaxonomic survey of the Pteridophyta of Australia. Austral. Syst. Bot. 15: 839–937.

08Occurrence & distribution

Record type1 024 records

Wild obs. + sensor425

Museum / vouchered538

Other61

Origin

Native80

Range

Area of Occupancy AOO2 988 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 267≤1 km 29≤10 km 10>10 km 27

333 georeferenced · 92 without coordinates

Open the mapobservation + sensor425

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy47% within 1 km

≤100 m 181≤1 km 41≤10 km 202>10 km 52

476 georeferenced · 62 without coordinates

Open the institutions mapphysical evidence538

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions15 of 19 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	281
Mount Annan, AU	81
Canberra, AU	43
Smithfield, AU	41
Museo Entomologico de Leonlocation not on record	22
Armidale, AU	16
NSW Dept of Planning, Industry and Environmentlocation not on record	7
James Cook Townsvillelocation not on record	7
Palmerston, AU	7
Parkville, AU	5
Wollongong, AU	5
Kew, GB	5
Adelaide, AU	3
Kensington, AU	2
John T. Waterhouse Herbariumlocation not on record	1
Hobart, AU	1
South Kensington, GB	1
Christchurch, NZ	1
Auckland, NZ	1

19 institutions · 530 of 538 vouchered records shown · 8 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Adiantum atroviride

At a glance

Sources4 archives

Size & morphology3

Life cycle & reproduction4

Diet & foraging1

Habitat & environment7

Physiology & chemistry2

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 024 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions15 of 19 geolocated

Record type1 024 records