Adialytus salicaphis

(Fitch, 1855) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Braconidae/Adialytus

At a glance

Occurrence records205

Data sources6

Biological traits0

DNA specimens19

eDNA detections1

Sources6 archives

Databases and archives Adialytus salicaphis's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility205 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics19 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF205 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD19 specimens

01Narrative

Adialytus salicaphis is een insect dat behoort tot de orde vliesvleugeligen (Hymenoptera) en de familie van de schildwespen (Braconidae). De wetenschappelijke naam van de soort werd voor het eerst geldig gepubliceerd door Fitch in 1855.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding19 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adialytus salicaphis has left across the world's sequence archives.

At a glance

DNA specimens19

BINs1

Marker genes2

eDNA detections1

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P656 bp consensus16 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)0.92%

Haplotypes2

BIN1

Most divergent pair0.46%

Where individuals differ — all 18 variable positions, in barcode order

23Avariable

35Gvariable

218Tmostly conserved

275Tmostly conserved

296Amostly conserved

314Gvariable

335Tvariable

338Tvariable

371Avariable

410Amostly conserved

422Cmostly conserved

500Avariable

501Tmostly conserved

528Gmostly conserved

584Gmostly conserved

602Tmostly conserved

629Gmostly conserved

638Tmostly conserved

TTTTATATTTTATTTTTGGTATATGATCTGGTATGTTAGGTTTATCTATAAGATTAATTATTCGAATAGAATTAAGTGTAGCAGGTAGAT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adialytus thelaxissame genus5.4%Lysiphlebus fabarumsame family5.4%Lysiphlebus confusussame family5.4%Aphidius cingulatussame family5.8%Lysiphlebus hirticornissame family5.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

08Occurrence & distribution

Record type205 records

Wild obs. + sensor16

Museum / vouchered189

Origin

Native2

Range

Area of Occupancy AOO144 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy94% within 1 km

≤100 m 1≤1 km 14≤10 km 1

16 georeferenced

Open the mapobservation + sensor16

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy25% within 1 km

≤1 km 27≤10 km 72>10 km 11

110 georeferenced · 79 without coordinates

Open the institutions mapphysical evidence189

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Laboratory of Systematic Entomology, The Hokkaido University Museum, Hokkaido University, Sapporo, Japanlocation not on record	73
Essig Museum of Entomologylocation not on record	73
WIlocation not on record	14
Ciudad de México, MX	14
UVEG-ENVlocation not on record	6
Eszterhazy Karoly University of Applied Scienceslocation not on record	3
I.I. Schmalhausen Institute of Zoologylocation not on record	2
Helsinki, FI	2
UKY-HIClocation not on record	1

9 institutions · 188 of 189 vouchered records shown · 1 without an institution code

09Environmental DNA1 detections

Where the DNA of Adialytus salicaphis was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)