Adia cinerella

(Fallén, 1825) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Diptera/Anthomyiidae/Adia

At a glance

Occurrence records1 965

Data sources7

Biological traits0

DNA specimens3 265

eDNA detections4 826

Sources7 archives

Databases and archives Adia cinerella's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 965 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 826 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 265 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 965 records

Environmental DNA5 datasets · 19 countries4 826 detections

DNA & barcodingBOLD3 265 specimens

01Narrative

Adia cinerella is a species of fly in the genus Adia. They are distributed from Yukon Territory to Greenland, Mexico, Georgia, the Bermuda islandsBioSystematic Database of World Diptera (BDWD): CoL 2009 Annual Checklist and Europe.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding3 265 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adia cinerella has left across the world's sequence archives.

At a glance

DNA specimens3 265

BINs1

Marker genes2

eDNA detections4 826

Countries19

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus3 258 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 11 variable positions, in barcode order

12Cmostly conserved

51Amostly conserved

165Gmostly conserved

183Amostly conserved

211Tmostly conserved

288Avariable

315Gmostly conserved

372Amostly conserved

507Tmostly conserved

633Tmostly conserved

651Tmostly conserved

ACACTATATTTCATTTTTGGAGCTTGATCAGGTATAGTAGGGACTTCATTAAGTATTCTAATTCGAGCTGAATTAGGACACCCTGGAGCT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 40 commonest of 258 variants.

Diversity (π)0.61%

Haplotypes258

BIN1

Most divergent pair7.0%

AsiaN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Paregle audaculasame family5.1%Botanophila striolatasame family5.2%Myopinella appendiculatasame family5.9%Paralucilia paraensissame order6.2%Botanophila gnavasame family6.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S

animal barcoderibosomal

08Occurrence & distribution

Record type1 965 records

Wild obs. + sensor1 471

Museum / vouchered473

Cultivated / captive20

Fossil1

Range

Area of Occupancy AOO2 724 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 422≤1 km 1 002≤10 km 22

1 446 georeferenced · 25 without coordinates

Open the mapobservation + sensor1 471

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy83% within 1 km

≤100 m 312≤1 km 66≤10 km 73>10 km 3

454 georeferenced · 19 without coordinates

Open the institutions mapphysical evidence473

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 20 records without

Open the mapnot free-living20

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 18 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Champaign, US	102
South Kensington, GB	79
Tromsø, NO	18
Helsinki, FI	10
IMEDEAlocation not on record	9
SLU Artdatabankenlocation not on record	7
DFFW2016location not on record	5
Stockholm, SE	4
Instytut Systematyki i Ewolucji Zwierząt Polskiej Akademii Nauklocation not on record	4
University of Tokyo, Department of Zoologylocation not on record	3
CBDClocation not on record	2
Iwate Prefectural Museumlocation not on record	1
DFlocation not on record	1
KwaZulu-Natal Museumlocation not on record	1
Rovaniemi, FI	1
ULLlocation not on record	1
Bavarian State Collection of Zoologylocation not on record	1
Centre for Biodiversity Genomicslocation not on record	1

18 institutions · 250 of 473 vouchered records shown · 223 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA4 826 detections

Where the DNA of Adia cinerella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4 826

Studies independent surveys5

Countries19

Verifiable raw sequence linked613

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 826 detections have coordinates

Open the map19 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median16.5 °C 12.0–23.8

Seasonal swing summer↔winter19.9 °C

Max temp (day)22.5 °C 16.9–31.2

Min temp (night)10.2 °C 6.20–17.0

Precipitation26.4 mm/mo 4.80–125

Air humidity50.2 % 38.5–60.4

Moisture balance-97.9 mm/mo -177–14.6

Vapour deficit993 Pa 610–1,536

Wind speed2.60 m/s 1.60–4.10

Cloud cover32.0 % 12.5–50.3

CHELSA 1981–2010, ~9 km grid, at location & month of 4 821 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Adia cinerella

At a glance

Sources7 archives

At a glance

Record type1 965 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions6 of 18 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 965 records