Adhemarius ypsilon

Rothschild & Jordan, 1903 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Sphingidae/Adhemarius

At a glance

Occurrence records883

Data sources7

Biological traits0

DNA specimens168

eDNA detections161

Sources7 archives

Databases and archives Adhemarius ypsilon's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility883 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI161 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics168 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF883 records

Environmental DNA1 datasets · 7 countries161 detections

DNA & barcodingBOLD168 specimens

01Narrative

Adhemarius ypsilon is a species of moth in the family Sphingidae. It was described by Rothschild and Jordan in 1903Adhemarius ypsilon Sphingidae of the Americas and is known from Costa Rica, Mexico, Belize, Guatemala, Nicaragua, Venezuela, French Guiana, Ecuador, Peru, and Bolivia. The wingspan is 89–117 mm for males and 107–126 mm for females. In Costa Rica, moths in this species take flight year round. The larvae feed on several species in the plant genus Ocotea (including Ocotea veraguensis, Ocotea atirrensis, Ocotea sarah and Ocotea dendrodaphne). Adhemarius ypsilon MHNT femelle dos.jpg|Female - dorsal side Adhemarius ypsilon MHNT femelle ventre.jpg|Female - ventral side Adhemarius ypsilon MHNT male dos.jpg|Male - dorsal side Adhemarius ypsilon MHNT male ventre.jpg|Male - ventral side

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding168 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adhemarius ypsilon has left across the world's sequence archives.

At a glance

DNA specimens168

BINs1

Marker genes4

eDNA detections161

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus157 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

197Tmostly conserved

415Amostly conserved

AACATTATATTTTATTTTTGGAATTTGATCTGGAATAGTAGGAACCTCCTTAAGATTACTAATTCGTGCAGAATTAGGAAACCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.15%

Haplotypes8

BIN1

Most divergent pair1.1%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adhemarius roesslerisame genus4.6%Adhemarius gannascussame genus5.3%Adhemarius eurysthenessame genus5.3%Adhemarius palmerisame genus5.8%Adhemarius gagarinisame genus6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18SEF1-alphaWnt1

animal barcoderibosomalmarker

08Occurrence & distribution

Record type883 records

Wild obs. + sensor226

Museum / vouchered631

Other26

Origin

Native2

Range

Area of Occupancy AOO976 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 92≤1 km 56≤10 km 6>10 km 5

159 georeferenced · 67 without coordinates

Open the mapobservation + sensor226

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy84% within 1 km

≤100 m 66≤1 km 3≤10 km 11>10 km 2

82 georeferenced · 549 without coordinates

Open the institutions mapphysical evidence631

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 16 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	393
Mexico City, MX	50
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	38
South Kensington, GB	24
FLMNH-UFlocation not on record	16
New Haven, US	13
Uniwersytet Jagiellońskilocation not on record	10
Natural History Museum of Utahlocation not on record	5
University of Pennsylvanialocation not on record	3
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	2
Natural History Museum Rotterdamlocation not on record	2
Tartu, EE	1
Area de Conservacion Guanacastelocation not on record	1
Mississippi State, US	1
Cornell University Insect Collectionlocation not on record	1
Cleveland Museum of Natural History, OH (CLEV)location not on record	1

16 institutions · 561 of 631 vouchered records shown · 70 without an institution code

09Environmental DNA161 detections

Where the DNA of Adhemarius ypsilon was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found161

Studies independent surveys1

Countries7

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 161 detections have coordinates

Open the map7 countries0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 22.8–25.6

Seasonal swing summer↔winter2.40 °C

Max temp (day)27.1 °C 25.6–29.6

Min temp (night)21.6 °C 19.7–22.6

Precipitation299 mm/mo 65.0–468

Air humidity69.2 % 64.4–75.5

Moisture balance158 mm/mo -98.3–334

Vapour deficit865 Pa 717–1,172

Wind speed2.50 m/s 1.00–4.60

Cloud cover32.0 % 16.1–42.5

CHELSA 1981–2010, ~9 km grid, at location & month of 159 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)