Adhemarius fulvescens

Closs, 1915 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Sphingidae/Adhemarius

At a glance

Occurrence records371

Data sources6

Biological traits0

DNA specimens126

eDNA detections134

Sources6 archives

Databases and archives Adhemarius fulvescens's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility371 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI134 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics126 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF371 records

Environmental DNA1 datasets · 5 countries134 detections

DNA & barcodingBOLD126 specimens

01Narrative

Adhemarius fulvescens is a species of moth in the family Sphingidae. It was described by Gustav Adolf Closs in 1915, and is known from Mexico, Guatemala, Costa Rica and north-central Nicaragua. Adults are on wing in May, from July to August and again from October to November in Nicaragua.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding126 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adhemarius fulvescens has left across the world's sequence archives.

At a glance

DNA specimens126

BINs1

Marker genes1

eDNA detections134

Countries5

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus126 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 2 variable positions, in barcode order

235Cvariable

478Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGATCTGGAATAGTAGGAACCTCTTTAAGATTATTAATTCGAGCAGAATTAGGAAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.17%

Haplotypes11

BIN1

Most divergent pair0.76%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adhemarius jamaicensissame genus4.4%Adhemarius gannascussame genus4.6%Adhemarius daphnesame genus4.6%Adhemarius dentonisame genus4.7%Adhemarius eurysthenessame genus4.7%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type371 records

Wild obs. + sensor22

Museum / vouchered349

Range

Area of Occupancy AOO316 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy95% within 1 km

≤100 m 19≤1 km 2>10 km 1

22 georeferenced

Open the mapobservation + sensor22

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 348 without coordinates

Open the institutions mapphysical evidence349

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	332
South Kensington, GB	4
Mississippi State, US	2
University of Pennsylvanialocation not on record	1
Tartu, EE	1

5 institutions · 340 of 349 vouchered records shown · 9 without an institution code

09Environmental DNA134 detections

Where the DNA of Adhemarius fulvescens was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found134

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 134 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.0 °C 23.1–25.2

Seasonal swing summer↔winter2.50 °C

Max temp (day)27.2 °C 26.1–29.2

Min temp (night)21.4 °C 20.1–21.9

Precipitation344 mm/mo 65.5–485

Air humidity70.2 % 64.4–75.7

Moisture balance187 mm/mo -98.3–349

Vapour deficit881 Pa 707–1,128

Wind speed2.50 m/s 1.10–3.80

Cloud cover38.8 % 15.1–42.5

CHELSA 1981–2010, ~9 km grid, at location & month of 134 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)