Adetus postilenatus

Bates, 1885 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Cerambycidae/Adetus

At a glance

Occurrence records17

Data sources7

Biological traits0

DNA specimens6

eDNA detections4

Sources7 archives

Databases and archives Adetus postilenatus's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility17 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI4 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics6 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF17 records

Environmental DNA1 datasets · 2 countries4 detections

DNA & barcodingBOLD6 specimens

01Narrative

Adetus postilenatus is a species of beetle in the family Cerambycidae. It was described by Henry Walter Bates in 1885.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding6 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adetus postilenatus has left across the world's sequence archives.

At a glance

DNA specimens6

Marker genes1

eDNA detections4

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P407 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 40 variable positions, in barcode order

20Tmostly conserved

26Amostly conserved

32Tmostly conserved

35Tmostly conserved

53Tmostly conserved

65Gmostly conserved

74Tmostly conserved

104Tmostly conserved

110Cvariable

131Tmostly conserved

167Tmostly conserved

177Cmostly conserved

200Tmostly conserved

212Cvariable

215Amostly conserved

221Cmostly conserved

233Tmostly conserved

242Amostly conserved

245Cmostly conserved

248Amostly conserved

263Cmostly conserved

266Amostly conserved

275Tmostly conserved

284Amostly conserved

287Tmostly conserved

291Cmostly conserved

293Tmostly conserved

305Tmostly conserved

306Cmostly conserved

317Amostly conserved

323Tmostly conserved

326Amostly conserved

327Cmostly conserved

335Tmostly conserved

341Tmostly conserved

365Tvariable

368Tvariable

371Ahighly variable

377Gvariable

401Cvariable

TAAGATTTTGATTACTTCCTCCTTCACTTACTCTTTTAATTATAAGAAGAATTGTAGAAAATGGGGCAGGAACTGGATGAACTGTATATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)5.3%

Haplotypes3

BINs0

Most divergent pair9.1%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adetus nesiotessame genus9.6%Adetus mucoreussame genus13.1%Eodorcadion gorbunovisame family13.8%Alcyopis chalceasame family13.8%Chrysobothris guadeloupensissame order13.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type17 records

Museum / vouchered17

Range

Area of Occupancy AOO16 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 17 records without

Open the institutions mapphysical evidence17

10Collections & institutions

Holding institutions1 of 3 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	7
Instituto Nacional de Biodiversidad, Costa Ricalocation not on record	5
Washington, US	4

3 institutions · 16 of 17 vouchered records shown · 1 without an institution code

09Environmental DNA4 detections

Where the DNA of Adetus postilenatus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found4

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 4 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.7 °C 24.6–25.6

Seasonal swing summer↔winter1.20 °C

Max temp (day)27.2 °C 26.7–28.1

Min temp (night)23.2 °C 22.9–23.7

Precipitation393 mm/mo 266–544

Air humidity74.3 % 73.3–77.1

Moisture balance267 mm/mo 123–422

Vapour deficit799 Pa 711–874

Wind speed1.00 m/s 0.9–1.30

Cloud cover41.1 % 27.6–48.1

CHELSA 1981–2010, ~9 km grid, at location & month of 4 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)