Adetomyrma venatrix

Ward, 1994 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hymenoptera/Formicidae/Adetomyrma

At a glance

Occurrence records56

Data sources8

Biological traits0

DNA specimens14

eDNA detections5

Sources8 archives

Databases and archives Adetomyrma venatrix's data was compiled from.

WikipediaWikimedia Foundation6 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility56 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI5 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics14 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF56 records

Environmental DNA1 datasets · 1 countries5 detections

DNA & barcodingBOLD14 specimens

01Narrative

Adetomyrma venatrix, more commonly known as the Dracula ant, so named because of its grisly feeding habits of drinking the blood of its young, is an endangered species of ants endemic to Madagascar. Workers of this species are blind. The species was described as the type species of Adetomyrma in 1994, with the genus being an atypical member of its tribe.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding14 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adetomyrma venatrix has left across the world's sequence archives.

At a glance

DNA specimens14

BINs1

Marker genes1

eDNA detections5

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P657 bp consensus5 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Diversity (π)1.3%

Haplotypes0

BIN1

Where individuals differ — all 18 variable positions, in barcode order

37Tvariable

42Cmostly conserved

55Amostly conserved

141Tmostly conserved

239Gmostly conserved

282Cmostly conserved

299Gmostly conserved

339Cmostly conserved

345Cmostly conserved

366Tmostly conserved

389Cmostly conserved

396Tmostly conserved

453Tmostly conserved

535Tmostly conserved

585Tvariable

588Cvariable

616Cmostly conserved

630Amostly conserved

ATTTTATATTTTTTATTTGCTATCTGAGCTAGAATATTAGGCTCATCAATAAGAATAATTATTCGATTAGAATTAGGTACTTGTAATTCT …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adetomyrma aureocupreasame genus6.8%Adetomyrma caputleaesame genus8.7%Adetomyrma goblinsame genus12.3%Adetomyrma bresslerisame genus12.8%Stigmatomma tsyhadysame family14.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type56 records

Museum / vouchered56

Range

Area of Occupancy AOO44 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 56 records without

Open the institutions mapphysical evidence56

10Collections & institutions

Holding institutions1 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
CASlocation not on record	44
California Academy of Scienceslocation not on record	7
Cambridge, US	2
MCZClocation not on record	2

4 institutions · 55 of 56 vouchered records shown · 1 without an institution code

09Environmental DNA5 detections

Where the DNA of Adetomyrma venatrix was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found5

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 5 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.4 °C 23.8–24.4

Seasonal swing summer↔winter6.80 °C

Max temp (day)28.5 °C 27.9–28.5

Min temp (night)19.7 °C 19.3–19.7

Precipitation182 mm/mo 182–219

Air humidity62.5 % 62.4–62.5

Moisture balance16.9 mm/mo 16.9–38.2

Vapour deficit1,139 Pa 1,105–1,139

Wind speed2.40 m/s 2.40–3.30

Cloud cover57.6 % 57.6–58.9

CHELSA 1981–2010, ~9 km grid, at location & month of 5 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)