Adesmia muricata

(Jacq.) DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Adesmia

At a glance

Occurrence records88

Data sources10

Biological traits13

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Adesmia muricata's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility88 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources13 traits

Occurrence & distributionGBIF88 records

Environmental DNA1 datasets · 1 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB2n = 20

01Narrative

Adesmia muricata là một loài thực vật có hoa trong họ Đậu. Loài này được (Jacq.) DC. miêu tả khoa học đầu tiên.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction3

Life formsubshrub

Life spanannual

Raunkiær life formtherophyte

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max2 600 m

Elevation min0 m

Epiphyteterrestrial

Growth formherb

Habitat GIFTCampo Limpo

Woodinessnon-woody

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adesmia muricata has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes2

GenBank sequences5

eDNA detections2

Countries3

The DNA barcodea real sequence read deposited for this species

ITSPQ536132.1 ↗255 bp

ACGT

CGCCTGCCTGGGTGTCACTAACCGTATCCCCAACACCCGTCGCCCTCGGGCGTCGGGAAGGGGCAAATGATGGCCTCCCGCGTGCCTTGC …

Adesmia muricata var. dentata isolate AdMurTafVall 5.8S ribosomal RNA gene, partial sequence; internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS5★ITS2

fungal barcode

06Genome at a glanceCCDB

The complete instruction manual Adesmia muricata carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Ploidydiploid inferred

Chromosome records20–202n range20median20mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 202×CCDB · ipcn-api-dl · CCDB · book-ipcn75-78

CCDB · ipcn-api-dl — Miotto, S. T. S. & E. R. Forni-Martins. 1994. Número cromossòmico em espécies brasileiras de Adesmia DC. (Leguminosae---Faboideae). Acta Bot. Brasil. 8(1): 3–9.

CCDB · book-ipcn75-78 — Fernandez 1977

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type88 records

Wild obs. + sensor33

Museum / vouchered55

Origin

Native4

Range

Area of Occupancy AOO264 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy58% within 1 km

≤100 m 7≤1 km 4≤10 km 8

19 georeferenced · 14 without coordinates

Open the mapobservation + sensor33

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 55 records without

Open the institutions mapphysical evidence55

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions10 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Córdoba, AR	11
Paris, FR	9
San Jose State University, Museum of Birds and Mammalslocation not on record	5
Saint Louis, US	4
Corrientes, AR	4
Chicago, US	3
Porto Alegre, BR	3
San Isidro, AR	3
Universidade Federale do Rio Grande do Sullocation not on record	3
Bronx, US	2
LDlocation not on record	2
EL PASO, US	1
Laboratorio de Ictiologialocation not on record	1
La Paz, BO	1
ASUlocation not on record	1

15 institutions · 53 of 55 vouchered records shown · 1 without an institution code

09Environmental DNA2 detections

Where the DNA of Adesmia muricata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median15.9 °C 15.9–15.9

Seasonal swing summer↔winter15.7 °C

Max temp (day)21.8 °C

Min temp (night)11.5 °C

Precipitation66.4 mm/mo

Air humidity54.7 %

Moisture balance-49.9 mm/mo

Vapour deficit875 Pa

Wind speed3.80 m/s

Cloud cover27.2 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)