Adesmia microphylla — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Adesmia

At a glance

Occurrence records126

Data sources7

Biological traits15

DNA specimens0

eDNA detections0

Sources7 archives

Databases and archives Adesmia microphylla's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility126 records↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

WikidataWikimedia Foundationstructured facts↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF126 records

DNA & barcodingNCBIsequences

01Narrative

Adesmia microphylla, pahuen, is a common shrub in Coastal Chilean Matorral of Central Chile, 400 to 1000 masl., associates with Proustia pungens and Lithrea caustica. This species was merged as A. arborea, a taxon including A. confusa Ulibarri, a distinctive plant with flowers over brachyblasts. The flowers of A. microphylla appear over spines.Ulibarri EA. 1986 Darwiniana 27, 315

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass5.62 mg

Seed mass max5.9 mg

Seed mass min5.17 mg

Life cycle & reproduction2

Life formshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max1 500 m

Elevation min0 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding2 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adesmia microphylla has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSPP378370.1 ↗651 bp

ACGT

CGGGGCGTCGGCGCTGCTTCTCGCACGTCGTTTCCCCCAAGGCGCGGGGAAGGTTGCTGCCTCGGCGGCACCCCTCCACGTGCTGCAACA …

Adesmia microphylla voucher NL-1423 (SGO) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS2

fungal barcode

08Occurrence & distribution

Record type126 records

Wild obs. + sensor76

Museum / vouchered50

Range

Area of Occupancy AOO384 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy85% within 1 km

≤100 m 30≤1 km 5≤10 km 4>10 km 2

41 georeferenced · 35 without coordinates

Open the mapobservation + sensor76

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1>10 km 4

5 georeferenced · 45 without coordinates

Open the institutions mapphysical evidence50

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UChlocation not on record	22
Valparaiso, CL	7
Kew, GB	6
Edinburgh, GB	4
San Isidro, AR	2
PLAlocation not on record	2
UNESP-FCAlocation not on record	2
Valparaíso, CL	1
Chicago, US	1
MeiseBGlocation not on record	1
University of Stellenboschlocation not on record	1
Saint Louis, US	1

12 institutions · 50 of 50 vouchered records shown