Adesmia argentea

Meyen · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Adesmia

At a glance

Occurrence records850

Data sources4

Biological traits15

DNA specimens0

eDNA detections0

Sources4 archives

Databases and archives Adesmia argentea's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility850 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources15 traits

Occurrence & distributionGBIF850 records

DNA & barcodingNCBIsequences

01Narrative

Adesmia argentea, en espagnol la barrilla blanca de Chile, est une espèce de plantes à fleurs de la famille des Fabaceae. C'est un arbuste très présent au Chili. Synonymes : - Adesmia cinerea Clos - Patagonium argenteum (Meyen) Kuntze - Patagonium cinereum (Clos) Kuntze L’aire d'origine de cette espèce est le Pérou. C’est un arbuste qui pousse principalement dans le biome subtropical.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology3

Seed mass3.25 mg

Seed mass max3.25 mg

Seed mass min3.25 mg

Life cycle & reproduction2

Life formshrub

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Elevation max2 000 m

Elevation min0 m

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adesmia argentea has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSPP378397.1 ↗652 bp

ACGT

TCGGGGCGTCGGCGCTGCTTCTCGCACGTCGGCTCCCCCAAGGCGCGGGGAAGGGCGATGCCTCGGCGGCACCCTTCCCCGTGCTGCAAC …

Adesmia argentea voucher NL-1270 (SGO) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type850 records

Wild obs. + sensor819

Museum / vouchered31

Origin

Native742

Range

Area of Occupancy AOO412 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 42≤1 km 2≤10 km 8>10 km 3

55 georeferenced · 764 without coordinates

Open the mapobservation + sensor819

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 31 records without

Open the institutions mapphysical evidence31

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Valparaiso, CL	8
UChlocation not on record	6
UNESP-FCAlocation not on record	6
Edinburgh, GB	3
Chicago, US	2
Saint Louis, US	2
San Isidro, AR	2
GAlocation not on record	1
University of Stellenboschlocation not on record	1

9 institutions · 31 of 31 vouchered records shown

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)