Adenostyles alpina

(L.) Bluff & Fingerh. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Asteraceae/Adenostyles

At a glance

Occurrence records36 913

Data sources10

Biological traits26

DNA specimens4

eDNA detections18

Sources10 archives

Databases and archives Adenostyles alpina's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility36 913 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI18 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources26 traits

Chemical compositionNPASS1 compounds

Occurrence & distributionGBIF36 913 records

Environmental DNA1 datasets · 1 countries18 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 38

01Narrative

L'Adénostyle des Alpes également appelée Adénostyle glabre est une espèce de plantes herbacées du genre Adenostyles et de la famille des Asteraceae (Composées). « Adenostyles » proviendrait du grec Aden : glande et studos : style. Les termes « alpina » et « glabra » font référence d'une part à son aire de répartition, et d'autre part au côté glabre de ses feuilles.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Plant height0.5 m

⚠ sources differ — GIFT: 0.5 m · TRY: 0.404 m

Plant height generative0.458 m

Plant height max0.6 m

Plant height min0.3 m

Seed length3 mm

Seed mass1.0 mg

⚠ sources differ — TRY: 1.0 mg · GIFT: 1.39 mg

Life cycle & reproduction7

Deciduousnessaestival

⚠ sources differ — TRY: aestival · GIFT: deciduous

Flowering endAug

Flowering startJul

Life formperennial

Life spanperennial

Lifespan years2 years

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Woodinessnon-woody

Physiology & chemistry5

Leaf C:N ratio17.47 g/g

Leaf c437 mg/g

Leaf dry-matter content (LDMC)143 mg/g

Leaf n25.66 mg/g

Photosynthetic pathwayC3

Other traits1

Diaspore typefruit

03Chemical composition1 compounds

Compounds documented for Adenostyles alpina across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Cadinane sesquiterpenoids1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Cacalol		present	NPASS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adenostyles alpina has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences10

eDNA detections18

Countries2

The DNA barcodea real sequence read deposited for this species

ITSOR511979.1 ↗683 bpItaly

ACGT

GTAACAAGGTTTCCGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCTTAGCAGAACGACCCGTGAACATGTAACAACAATTTGG …

Adenostyles alpina voucher FCO41472 small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1 and 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK★ITS10★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Adenostyles alpina carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 38 n = 19

Ploidydiploid inferred

Chromosome records38–382n range38median38mode6records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 386×CCDB · book-ipcn72 · CCDB · book-ipcn67-71 · CCDB · book-fedorov +1

CCDB · book-ipcn72 — LOVKA, M., F. SUSNIK, A. LOEVE, & D. LOEVE. 1972. In IOPB chromosome number reports XXXVI. Taxon 21: 333-346.

CCDB · book-ipcn67-71 — LEPPER, L. 1968. Uber Paradichlorbenzol als Vorbehandlungsmittel in der Chromosomentechnik. Wiss. z. Friedrich-Schiller-Univ. Jena, Math.-Naturwiss. Reihe 17: 375-379.

CCDB · book-ipcn67-71 — LOVKA, M., F. SUSNIK, A. LOEVE, & D. LOEVE. 1971. In IOPB chromosome number reports XXXIV. Taxon 20: 785-797:-

CCDB · book-fedorov — Contandriopoulos 1964b

CCDB · book-fedorov — Langlet 1936

CCDB · book-atlas-flowering-plants

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type36 913 records

Wild obs. + sensor36 050

Museum / vouchered640

Cultivated / captive3

Other220

Origin

Introduced1

Range

Area of Occupancy AOO20 396 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy60% within 1 km

≤100 m 4 924≤1 km 15 293≤10 km 13 216>10 km 391

33 824 georeferenced · 2 226 without coordinates

Open the mapobservation + sensor36 050

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy15% within 1 km

≤100 m 9≤1 km 48≤10 km 318>10 km 1

376 georeferenced · 264 without coordinates

Open the institutions mapphysical evidence640

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 2 without coordinates

Open the mapnot free-living3

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions21 of 42 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Salzburg, AT	213
Zürich, CH	85
Lausanne, CH	57
LDlocation not on record	34
Bern, CH	27
BClocation not on record	27
Karlsruhe, DE	22
Zürich, CH	19
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	17
Oskarshamn, SE	13
Institut und Museum fuer Geologie und Palaeontologielocation not on record	13
Glarus, CH	12
Porrentruy, CH	10
LfUlocation not on record	9
inatura Erlebnis Naturschau GmbHlocation not on record	6
Frauenfeld, CH	5
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	5
Wlocation not on record	5
BFLlocation not on record	4
Adam Mickiewicz University in Poznańlocation not on record	4
Görlitz, DE	4
Sion, CH	4
GJOlocation not on record	3
GZUlocation not on record	2
Mlocation not on record	2
San Jose State University, Museum of Birds and Mammalslocation not on record	2
Dresden, DE	2
CJBGlocation not on record	1
Saint Louis, US	1
Moscow State Universitylocation not on record	1
Logan, US	1
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	1
Fribourg, CH	1
Berlin, DE	1
BRNUlocation not on record	1
Podgorica, ME	1
CICYTEXlocation not on record	1
Muséum Henri Lecoqlocation not on record	1
Boumlocation not on record	1
Paris, FR	1
Barcelona, ES	1
Edinburgh, GB	1

42 institutions · 621 of 640 vouchered records shown · 18 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA18 detections

Where the DNA of Adenostyles alpina was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found18

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 18 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median7.00 °C 7.00–7.00

Seasonal swing summer↔winter19.8 °C

Max temp (day)11.2 °C

Min temp (night)2.10 °C

Precipitation170 mm/mo

Air humidity64.0 %

Moisture balance100 mm/mo

Vapour deficit403 Pa

Wind speed2.60 m/s

Cloud cover44.9 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Adenostyles alpina

At a glance

Sources10 archives

Size & morphology6

Life cycle & reproduction7

Diet & foraging1

Habitat & environment6

Physiology & chemistry5

Other traits1

Compound class profile1 class

Documented compounds1 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type36 913 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions21 of 42 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type36 913 records