Adenophora liliifolia

(L.) A.DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Asterales/Campanulaceae/Adenophora

At a glance

Occurrence records3 448

Data sources12

Biological traits28

DNA specimens24

eDNA detections49

Sources12 archives

Databases and archives Adenophora liliifolia's data was compiled from.

WikipediaWikimedia Foundation9 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility3 448 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI49 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics24 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources28 traits

Occurrence & distributionGBIF3 448 records

Environmental DNA2 datasets · 5 countries49 detections

DNA & barcodingBOLD · NCBI24 specimens

Genome at a glanceCCDB · GoaT4.3 Gbp

01Narrative

Adenophora liliifolia is a species of plants belonging to the family Campanulaceae. It is native to Europe and Northern America. Synonyms: Adenophora lilifolia (L.) Ledeb. ex A.DC.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology9

Leaf size1 264 mm²

Plant height0.45 m

⚠ sources differ — GIFT: 0.45 m · TRY: 0.667 m

Plant height generative0.65 m

Plant height max1.5 m

Plant height min0.5 m

Seed length2.01 mm

Seed mass0.4 mg

⚠ sources differ — TRY: 0.4 mg · GIFT: 0.355 mg

Seed mass max0.54 mg

Seed mass min0.2 mg

Life cycle & reproduction6

Deciduousnessaestival

⚠ sources differ — TRY: aestival · GIFT: deciduous

Flowering endJul

Flowering startJun

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatetemperate

Climberself-supporting

Epiphyteterrestrial

Growth formherb

Habitat GIFTforest, meadows, shrubberies, steppe

Mycorrhiza typearbuscular

Woodinessnon-woody

Physiology & chemistry3

Leaf dry-matter content (LDMC)212 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)36.43 mm²/mg

Other traits1

Diaspore typeone-seeded generative dispersule

05DNA & barcoding24 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adenophora liliifolia has left across the world's sequence archives.

At a glance

DNA specimens24

Marker genes5

GenBank sequences10

eDNA detections49

Countries5

The DNA barcodea real sequence read deposited for this species

ITSPQ451565.1 ↗296 bpKazakhstan

ACGT

CAAGAAACAAACCCCGGCGCAATTCGCGCCAAGGAAATCTTTAAACTCAAGGGCGTGCTCTCCTCACGTTGCCCCCGTTTGCGGGTGCGC …

Adenophora liliifolia voucher KS23 HER0097 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene, complete sequence; and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL3★rbcLa★ITS5★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Adenophora liliifolia carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size4 289 019 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

THIS GENOME Adenophora liliifolia4.29 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 34 n = 17

Ploidy2× diploid · measured

Chromosome records34–1022n range34median34mode18records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 3416×GoaT · Kew Plant DNA C-values Database · CCDB · slov-fl · CCDB · poland +8

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · slov-fl — Májovský J. et al., 1974b: Index of chromosome numbers of Slovakian flora Part 4. - Acta Fac. Rerum Nat. Univ. Comen., Bot. 23: 1-23.

CCDB · poland — Wcis?o H. 1983. Cytological observations on Campanulaceae from Poland. Acta Biol. Cracov. Ser. Bot. 25, 1-13.

CCDB · ipcn-api-dl — Wcislo, H. 1983. Cytological observations on Campanulaceae from Poland. Acta Biol. Cracov., Ser. Bot. 25: 1–13.

CCDB · ipcn-api-dl — Krasnikov, A. A. 1991. Chromosome numbers in some species of vascular plants from Novosibirsk region. Bot. Žhurn. (Moscow & Leningrad) 76: 476–479.

CCDB · ipcn-api-dl — HINDAKOVA, M. 1974. In Index to chromosome numbers of Slovakian flora. Part 4. Acta Fac. Rerum Nat. Univ. Comenianae, Bot. 23: 1–23.

CCDB · book-ipcn66 — Gadella 1966b

CCDB · book-ipcn67-71 — LOVKA, M., F. SUSNIK, A. LOEVE, & D. LOEVE. 1971. In IOPB chromosome number reports XXXIV. Taxon 20: 785-797:-

CCDB · book-ipcn75-78 — Hindakova 1974

CCDB · book-ipcn73-74 — MAJOVSKY, J., ET AL. 1974. Index of chromosome numbers of Slovakian Flora. (Part 4). Acta Fac. Rerum Nat. Univ. Comenianae Bot. 23: 1-23.

CCDB · book-fedorov — MOAHJI8BCRBi 1934

CCDB · book-fedorov — Gadella 1966

CCDB · book-fedorov — Marchal 1920 athoa B

CCDB · book-atlas-flowering-plants — Modilewski 1934

CCDB · kew — Siljak-Yakovlev S, Pustahija F, Šolic EM, Bogunic F, Muratovic E, Bašic N, Catrice O, Brown SC. 2010. Towards a genome size and chromosome number database of Balkan flora: C-values in 343 taxa with novel values for 242. Advanced Science Letters 3: 190-213

2n 1022×CCDB · book-fedorov · CCDB · book-atlas-flowering-plants

CCDB · book-fedorov — Sugiura 1941, 1942b arctica

CCDB · book-atlas-flowering-plants — Sugiura 1942

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type3 448 records

Wild obs. + sensor2 769

Museum / vouchered637

Cultivated / captive6

Other36

Origin

Native2

Introduced5

Range

Area of Occupancy AOO6 172 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy50% within 1 km

≤100 m 607≤1 km 252≤10 km 630>10 km 238

1 727 georeferenced · 1 042 without coordinates

Open the mapobservation + sensor2 769

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 12≤1 km 105≤10 km 151>10 km 84

352 georeferenced · 285 without coordinates

Open the institutions mapphysical evidence637

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy0% within 1 km

≤10 km 5

5 georeferenced · 1 without coordinates

Open the mapnot free-living6

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions17 of 49 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Moscow State Universitylocation not on record	318
KFGBlocation not on record	39
Zürich, CH	33
GZUlocation not on record	30
GBS RAN - Glavny Botanichesky Sad Rossijskoj Akademii Nauklocation not on record	22
Zürich, CH	16
BRNUlocation not on record	16
LDlocation not on record	14
GJOlocation not on record	14
Tula State Lev Tolstoy Pedagogical Universitylocation not on record	8
Beijing, CN	7
BFLlocation not on record	7
Wlocation not on record	6
Kostrzyca Forest Gene Banklocation not on record	6
The State Museum-Preserve "The Kulikovo pole"location not on record	5
KR	5
Bern, CH	5
Museum Ludovicae Ulricae, Zoology Institute of the University of Uppsalalocation not on record	4
Yangling, CN	4
Regensburgische Botanische Gesellschaftlocation not on record	4
Servico de Microbiologia e Imunologialocation not on record	4
Oskarshamn, SE	3
Museo civico di Storia naturale Giacomo Doria di Genova \| Giacomo Doria Natural History Museum in Genoalocation not on record	3
Urumqi, CN	3
The Tula Region State Institution of Culture "Tula Museum Association"location not on record	3
Provincia di Livornolocation not on record	3
Tula State Universitylocation not on record	2
Berlin, DE	2
Herbarium of South China Botanical Gardenlocation not on record	2
PRClocation not on record	2
Universität Göttingenlocation not on record	2
Elocation not on record	2
Tsukuba, JP	2
Staatliches Museum fuer Naturkunde Karlsruhe (State Museum of Natural History)location not on record	1
Durham, US	1
Naturhistorische Gesellschaft Nürnberg e.V.location not on record	1
Frankfurt am Main	1
NTNU University Museum, Department of Natural Historylocation not on record	1
Awka, NG	1
Plocation not on record	1
Philadelphia, US	1
Prioksko-Terrasnyi Biosphere Reservelocation not on record	1
Institut und Museum fuer Geologie und Palaeontologielocation not on record	1
Kyoto Universitylocation not on record	1
inatura Erlebnis Naturschau GmbHlocation not on record	1
Adam Mickiewicz University in Poznańlocation not on record	1
Salzburg, AT	1
Edinburgh, GB	1
Denver, US	1

49 institutions · 612 of 637 vouchered records shown · 21 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA49 detections

Where the DNA of Adenophora liliifolia was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found49

Studies independent surveys2

Countries5

Signal confidence: moderateweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 49 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.0 °C 15.2–18.6

Seasonal swing summer↔winter21.1 °C

Max temp (day)22.5 °C 18.0–23.1

Min temp (night)13.8 °C 10.2–14.2

Precipitation67.5 mm/mo 63.6–82.3

Air humidity59.4 % 59.1–59.5

Moisture balance-46.0 mm/mo -46.4–21.7

Vapour deficit841 Pa 690–871

Wind speed3.10 m/s 3.00–3.80

Cloud cover33.2 % 32.4–37.0

CHELSA 1981–2010, ~9 km grid, at location & month of 49 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Adenophora liliifolia

At a glance

Sources12 archives

Size & morphology9

Life cycle & reproduction6

Diet & foraging1

Habitat & environment8

Physiology & chemistry3

Other traits1

At a glance

Genome sizehow big the whole instruction manual is

Chromosomes & ploidyhow the DNA is packaged

Record type3 448 records

Origin

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions17 of 49 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type3 448 records