Adenopeltis serrata

(W.T.Aiton) I.M.Johnst. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Euphorbiaceae/Adenopeltis

At a glance

Occurrence records185

Data sources8

Biological traits10

DNA specimens3

eDNA detections3

Sources8 archives

Databases and archives Adenopeltis serrata's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility185 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources10 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF185 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Adenopeltis is a plant genus of the family Euphorbiaceae first described as a genus in 1832.Jussieu, Adrien Henri Laurent de. 1832. Annales des Sciences Naturelles (Paris) 25: 24-27 descriptions in Latin, commentary in FrenchTropicos, Adenopeltis Bertero ex A. Juss. Its name comes from Greek and means "glandular shield". It contains only one known species, Adenopeltis serrata, endemic to the central part of the Republic of Chile in South America.Kew World Checklist of Selected Plant FamiliesGovaerts, R., Frodin, D.G. & Radcliffe-Smith, A. (2000). World Checklist and Bibliography of Euphorbiaceae (and Pandaceae) 1-4: 1-1622. The Board of Trustees of the Royal Botanic Gardens, Kew.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Life cycle & reproduction3

Life formshrub

Life spanperennial

Raunkiær life formphanerophyte

Diet & foraging1

Parasiteindependent

Habitat & environment6

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Woodinesswoody

03Chemical composition1 compounds

Compounds documented for Adenopeltis serrata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Hydrocarbons1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Nonancosane		present	LOTUS

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adenopeltis serrata has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences4

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOQ429963.1 ↗691 bpChile

ACGT

CAAGGTTTCGGTAGGTGAACCTGCGGAAGGATCATTGTCGAAACCTGCAAAGCAGAACGACCCGCGAACCTGTCATGAACTCGTGGGGTC …

Adenopeltis serrata voucher SEP_1_7_EIF small subunit ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS1

plant barcodefungal barcode

08Occurrence & distribution

Record type185 records

Wild obs. + sensor157

Museum / vouchered28

Range

Area of Occupancy AOO432 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy87% within 1 km

≤100 m 89≤1 km 20≤10 km 10>10 km 6

125 georeferenced · 32 without coordinates

Open the mapobservation + sensor157

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 26 without coordinates

Open the institutions mapphysical evidence28

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 10 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
UChlocation not on record	8
Valparaiso, CL	7
Edinburgh, GB	4
Universität Tübingenlocation not on record	2
ASUlocation not on record	2
Herbario Universidad de Concepciónlocation not on record	1
MAlocation not on record	1
Ann Arbor, US	1
San Jose State University, Museum of Birds and Mammalslocation not on record	1
Severin-McDaniel Insect Collectionlocation not on record	1

10 institutions · 28 of 28 vouchered records shown

09Environmental DNA3 detections

Where the DNA of Adenopeltis serrata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)