Adenolisianthus arboreus

(Spruce ex Progel) Gilg · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Gentianaceae/Adenolisianthus

At a glance

Occurrence records210

Data sources5

Biological traits12

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Adenolisianthus arboreus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility210 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources12 traits

Occurrence & distributionGBIF210 records

DNA & barcodingNCBIsequences

01Narrative

Adenolisianthus is a plant genus in the gentian family (Gentianaceae), tribe Helieae. The name of the genus is derived from Greek roots meaning "gland-bearing and smooth flower". Only one species, Adenolisianthus arboreus, has been classified as part of this genus.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Life cycle & reproduction1

Life spanperennial

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatewet tropical

Climberself-supporting

Elevation max800 m

Elevation min0 m

Epiphyteterrestrial

Growth formtree

Habitat GIFTSavana Amazônica

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adenolisianthus arboreus has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

The DNA barcodea real sequence read deposited for this species

ITSEU709784.1 ↗281 bp

ACGT

TCGAATCCTGCGAAGCAGACCACCGGAGAACATGTTAAACTCACGGGCGTTTGGGATGGGGGAGACCCCGGACGGACGCCCTAACCACGA …

Adenolisianthus arboreus internal transcribed spacer 1, complete sequence; and 5.8S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★ITS1

fungal barcode

08Occurrence & distribution

Record type210 records

Wild obs. + sensor84

Museum / vouchered126

Origin

Native1

Range

Area of Occupancy AOO308 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy

no georeferenced coordinates · 84 records without

Open the mapobservation + sensor84

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤1 km 2≤10 km 3>10 km 1

6 georeferenced · 120 without coordinates

Open the institutions mapphysical evidence126

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 14 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Instituto Amazónico de Investigaciones Científicas - SINCHIlocation not on record	66
Saint Louis, US	12
Universidad Nacional de Colombia (UNAL)location not on record	12
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	8
Chicago, US	6
MAlocation not on record	5
University of Stellenboschlocation not on record	3
COLlocation not on record	2
Kew, GB	2
Instituto Amazónico de Investigaciones Científicas SINCHIlocation not on record	2
Universidad de Antioquia (UdeA)location not on record	2
JBRJlocation not on record	1
Istituto Agrario Castelnuovolocation not on record	1
Cambridge, US	1

14 institutions · 123 of 126 vouchered records shown · 3 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)