Adenodolichos baumii — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Adenodolichos

At a glance

Occurrence records10

Data sources5

Biological traits7

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Adenodolichos baumii's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility10 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources7 traits

Occurrence & distributionGBIF10 records

DNA & barcodingNCBIsequences

01Narrative

Adenodolichos baumii is a plant in the legume family Fabaceae, native to tropical Africa.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRYGIFT

Size & morphology1

Plant height1.5 m

Life cycle & reproduction2

Life formshrub

Life spanperennial

Habitat & environment3

Climateseasonally dry tropical

Growth formshrub

Woodinesswoody

Physiology & chemistry1

Photosynthetic pathwayC3

05DNA & barcoding1 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adenodolichos baumii has left across the world's sequence archives.

At a glance

Marker genes1

GenBank sequences1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSMT376874.1 ↗556 bpSouth Africa

ACGT

CAAAAACAAAAACCCGGGCCCCTCGTGCGTCAAGGAATAGAAAATTGTTCGGTGTGACCCCGGGAGGCCCAGAACAGGCGTTCNCCCCGG …

Adenodolichos baumii voucher Laveridge, JP. 403 (PRE) internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and large subunit ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS1

fungal barcode

08Occurrence & distribution

Record type10 records

Museum / vouchered10

Range

Area of Occupancy AOO36 km²

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 10 records without

Open the institutions mapphysical evidence10

10Collections & institutions

Holding institutions3 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	6
MeiseBGlocation not on record	1
Coimbra, PT	1
South Kensington, GB	1

4 institutions · 9 of 10 vouchered records shown · 1 without an institution code