Adenochilus nortonii

Fitzg. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Liliopsida/Asparagales/Orchidaceae/Adenochilus

At a glance

Occurrence records193

Data sources7

Biological traits22

DNA specimens3

eDNA detections3

Sources7 archives

Databases and archives Adenochilus nortonii's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility193 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources22 traits

Occurrence & distributionGBIF193 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

01Narrative

Adenochilus nortonii, commonly known as the white gnome orchid, is a plant in the orchid family Orchidaceae and is endemic to a few isolated locations in New South Wales. It has a long, thin underground rhizome, a single leaf and a single white flower with reddish glandular hairs on the outside. Its labellum has red bars and a central band of yellow calli.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology3

Leaf length30 mm

Leaf width12 mm

Leaf width max3 mm

Life cycle & reproduction7

Flowering endDec

Flowering startNov

Flowering timennnnnnnnnnyy

Life formperennial

Life spanperennial

Raunkiær life formhemicryptophyte

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment10

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Epiphyteterrestrial

Fruit fleshinessdry

Fruit typecapsule

Growth formherb

Leaf compoundnesssimple

Leaf shapeovate

Woodinessnon-woody

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adenochilus nortonii has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes3

GenBank sequences4

eDNA detections3

The DNA barcodea real sequence read deposited for this species

ITSAF347979.1 ↗696 bp

ACGT

ATCATTGTCGAGACCCAAAAAATATCGAGCAAATTTGACAACACGTGAATTCTTAATAAGGAGGCGGCGAATGCTGCCACCAAACACCCA …

Adenochilus nortonii 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 26S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL1★ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type193 records

Wild obs. + sensor49

Museum / vouchered136

Cultivated / captive8

Origin

Native30

Range

Area of Occupancy AOO320 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy74% within 1 km

≤100 m 32≤1 km 3≤10 km 5>10 km 7

47 georeferenced · 2 without coordinates

Open the mapobservation + sensor49

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy31% within 1 km

≤100 m 6≤1 km 33≤10 km 81>10 km 7

127 georeferenced · 9 without coordinates

Open the institutions mapphysical evidence136

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy38% within 1 km

≤100 m 1≤1 km 2≤10 km 5

8 georeferenced

Open the mapnot free-living8

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Canberra, AU	53
NSW Dept of Planning, Industry and Environmentlocation not on record	34
Mount Annan, AU	30
Smithfield, AU	6
Brisbane, AU	4
Armidale, AU	3
Adelaide, AU	3
Museo Entomologico de Leonlocation not on record	2
John T. Waterhouse Herbariumlocation not on record	1

9 institutions · 136 of 136 vouchered records shown

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA3 detections

Where the DNA of Adenochilus nortonii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)