Adenocarpus foliolosus

(Aiton) DC. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Fabales/Fabaceae/Adenocarpus

At a glance

Occurrence records835

Data sources15

Biological traits25

DNA specimens2

eDNA detections2

Sources15 archives

Databases and archives Adenocarpus foliolosus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility835 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

dukesphytochemcompounds

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources25 traits

Chemical compositionDukesPhytochem · LOTUS · NPASS60 compounds

Occurrence & distributionGBIF835 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceCCDB · GoaT875 Mbp

01Narrative

Adenocarpus foliolosus, known locally as codeso and commonly known as Canary Island flatpod is a shrubby species of flowering plant in the legume family Fabaceae, subfamily Faboideae, that is endemic to Canary Islands where it can be found in Tenerife, La Gomera, El Hierro, Gran Canaria and La Palma. It has yellow flowers, a narrow, oblong legume with sparse glands, compound leaves and short petioles 1 - long.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology6

Fruit length max50 mm

Fruit length min30 mm

Leaf length max6 mm

Leaf length min3 mm

Plant height max4 m

Plant height min2 m

Life cycle & reproduction7

Deciduousnessevergreen

Dehiscencedehiscent

Flower colouryellow

Flowering endJul

Flowering startJan

Life formshrub

Life spanperennial

Habitat & environment8

Climatesubtropical

Elevation max1 600 m

Elevation min500 m

Fruit colourgreen

Fruit typelegume

Growth formshrub

Leaf formlanceolate

Woodinesswoody

Physiology & chemistry3

Leaf n38.9 mg/g

Photosynthetic pathwayC3

Specific leaf area (SLA)14.93 mm²/mg

Other traits1

Inflorescenceraceme

03Chemical composition60 compounds

Compounds documented for Adenocarpus foliolosus across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

💊 Medicinal use documented

Compound class profile5 classes

Kaurane and Phyllocladane diterpenoids11

Flavonols7

Labdane diterpenoids4

Germacrane sesquiterpenoids3

Depsides $ Fungal DPEs3

Documented compounds60 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-taxifolin	present	NPASS
(-)-Cyperene	present	NPASS
(-)-Kaur-16-en-19-oic acid	present	NPASS
(1aS,3R,4R,4aR,6S,7R,8aS)-7-Chloro-3,6-dihydroxy-3,4a,8,8-tetramethyl-octahydro-1aH-naphtho[1-b]oxirene-4-carboxylic acid	present	LOTUS
(1E,6Z)-gamma-humulene	present	NPASS
(1R,4S,5R,9S,10S,13R,15S)-5,9-dimethyl-15-(3-methylbut-2-enoyloxy)-14-methylidenetetracyclo[11.2.1.01,10.04,9]hexadecane-5-carboxylic acid	present	NPASS
(1R,4S,5R,9S,10S,13R,15S)-5,9-dimethyl-15-(3-methylbutanoyloxy)-14-methylidenetetracyclo[11.2.1.01,10.04,9]hexadecane-5-carboxylic acid	present	NPASS
(1R,4S,5R,9S,10S,13R,15S)-5,9-dimethyl-15-[(E)-2-methylbut-2-enoyl]oxy-14-methylidenetetracyclo[11.2.1.01,10.04,9]hexadecane-5-carboxylic acid	present	NPASS
(1R,4S,5R,9S,10S,13R,15S)-5,9-dimethyl-15-[(Z)-2-methylbut-2-enoyl]oxy-14-methylidenetetracyclo[11.2.1.01,10.04,9]hexadecane-5-carboxylic acid	present	NPASS
(1R,5S,8S)-1,5-dimethyl-8-[2-[(1R,5S)-6-methylidene-2-oxo-1-bicyclo[3.2.1]octanyl]ethyl]-6-oxabicyclo[3.2.1]octan-7-one	present	NPASS

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adenocarpus foliolosus has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes4

GenBank sequences7

eDNA detections2

Countries1

The DNA barcodea real sequence read deposited for this species

ITSZ72297.1 ↗220 bp

ACGT

CATCGTTGCCCCTGTGCCTTGGCCACGTGCTAGGCACCGAGCGGGGCGAATGTTGGCTTCCCGCGAGCAGCGTCTCACGGTTGGTTGAAA …

Adenocarpus foliolosus ITS2

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL2★ITS4★ITS2

plant barcodefungal barcode

06Genome at a glanceCCDB · GoaT

The complete instruction manual Adenocarpus foliolosus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size875 310 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Adenocarpus foliolosus0.88 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 52 n = 26

Ploidy4× tetraploid · measured

Chromosome records26–522n range52median52mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 527×GoaT · Kew Plant DNA C-values Database · CCDB · iber-fl · CCDB · ipcn-api-dl +3

GoaT · Kew Plant DNA C-values Database — ↗

CCDB · iber-fl — Estudio cariolgico del gnero Adenocarpus DC. Horjales, M.Trab. Dept. Bot. Fisiol. Veg. Madrid5: 3-44(1972).

CCDB · iber-fl — Variabilidad cromosmica de las Genisteas de la flora espaola en relaccin con su ecologa. I. Saudo, A.Lagascalia3(2): 205-210(1973).

CCDB · ipcn-api-dl — Cubas, P., C. Pardo, D. S. Mata & P. Cantó. 1998. Números cromosómicos para la flora expañola. 780--792. Lagascalia 20(2): 295–302.

CCDB · book-ipcn72 — HORJALES, LAUCES M. 1972. Estudios cariologicos del genera Adenocarpus DC. Trab. Dep. Botanica y F. Veg. 5: 3-44.

CCDB · book-ipcn73-74 — SANUDO, A. 1973. Variabilidad cromosomica de las Genisteas de la flora espanola en relacion con su ecolgia. I. Numero y compportamiento de los cromosomas durante la meiosis. c. Generos Chronanthus (DC.) C. Koch, Adenocarpus DC. y Erinacea Adanson. Lagascalia 3: 205 210.

CCDB · kew — Suda J, Kyncl T, Jarolimova V. 2005. Genome size variation in Macaronesian angiosperms: forty percent of the Canarian endemic flora completed. Plant Systematics and Evolution 252: 215-238.

2n 261×CCDB · ipcn-api-dl

CCDB · ipcn-api-dl — Bramwell, D., J. P. Paz & J. Ortega. 1976. Studies in the flora of Macaronesia: some chromosome numbers of flowering plants. Bot. Macaronés. IV, Cien. 1: 9–16.

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

tetraploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

diploid inferred1×PloiDB · genus-scale

PloiDB · genus-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type835 records

Wild obs. + sensor716

Museum / vouchered119

Range

Area of Occupancy AOO1 004 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy61% within 1 km

≤100 m 227≤1 km 145≤10 km 228>10 km 9

609 georeferenced · 107 without coordinates

Open the mapobservation + sensor716

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy74% within 1 km

≤100 m 3≤1 km 31≤10 km 12

46 georeferenced · 73 without coordinates

Open the institutions mapphysical evidence119

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions18 of 31 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
LDlocation not on record	15
BClocation not on record	11
València, ES	7
Saint Louis, US	7
MAlocation not on record	5
Museo Achille Folettolocation not on record	5
Alicante, ES	5
Edinburgh, GB	5
Barcelona, ES	4
Vitoria, ES	3
College of the Atlantic, Museumlocation not on record	3
Entomological Society of Latvialocation not on record	3
Pamplona, ES	3
Canadian Department of Agriculturelocation not on record	3
Santiago de Compostela, ES	2
San Sebastián, ES	2
Uppsala, SE	2
South Kensington, GB	2
Universidad del Pais Vasco (UPV/EHU)location not on record	2
Salamanca, ES	2
Frankfurt am Main	2
Moscow State Universitylocation not on record	2
Madrid, ES	2
MeiseBGlocation not on record	1
Granada, ES	1
Stockholm, SE	1
Bronx, US	1
Wlocation not on record	1
John May Museum of Natural Historylocation not on record	1
Kew, GB	1
University of Stellenboschlocation not on record	1

31 institutions · 105 of 119 vouchered records shown · 13 without an institution code

09Environmental DNA2 detections

Where the DNA of Adenocarpus foliolosus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)