Adenium obesum

(Forssk.) Roem. & Schult. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Gentianales/Apocynaceae/Adenium

At a glance

Occurrence records1 100

Data sources13

Biological traits22

DNA specimens4

eDNA detections10

Sources13 archives

Databases and archives Adenium obesum's data was compiled from.

WikipediaWikimedia Foundation18 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 100 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI10 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics4 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

NPASSNat. Product Activity & Species Sourcecompounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

CCDBChromosome Counts DB · Tel Aviv U.genome & karyotype↗

PloiDBPloidy Databasegenome & karyotype

WikidataWikimedia Foundationstructured facts↗

On this page7 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources22 traits

Chemical compositionLOTUS · NPASS84 compounds

Occurrence & distributionGBIF1 100 records

Environmental DNA1 datasets · 3 countries10 detections

DNA & barcodingBOLD · NCBI4 specimens

Genome at a glanceCCDB2n = 22

01Narrative

Adenium obesum is a poisonous species of flowering plant belonging to the tribe Nerieae of the subfamily Apocynoideae of the dogbane family, Apocynaceae. It is native to the Sahel regions south of the Sahara (from Mauritania and Senegal to Sudan), tropical and subtropical eastern and southern Africa and also the Arabian Peninsula. Common names include Sabi star, kudu, mock azalea, impala lily and desert rose. Adenium obesum is a popular houseplant and bonsai in temperate regions.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology3

Plant height2.5 m

⚠ sources differ — GIFT: 2.5 m · TRY: 1.5 m

Plant height max1.83 m

Plant height min1.22 m

Life cycle & reproduction8

Deciduousnessdeciduous

Dispersal typewind

Life formsemisucculent shrub

Life spanperennial

Lifeform raunkiaer detailednanophanerophyte

Lifespan years17 years

Pollination modebiotic

Pollination syndromeinsect

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatedesert or dry shrubland

Climberself-supporting

Epiphyteterrestrial

Growth formshrub

Habitat GIFTin dry bushland, especially in rocky sites, on the coast also in woodland

Mycorrhiza typearbuscular

Woodinesswoody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

Other traits1

Plant support typefree-standing

03Chemical composition84 compounds

Compounds documented for Adenium obesum across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile5 classes

Cardenolides47

Spirostane steroids19

Furostane steroids8

Disaccharides $ Polysaccharides3

Stigmastane steroids2

Documented compounds84 total

Tissue Source Quantified only

Compound	Amount	Source
(+)-Dioscin	present	NPASS
(25S)-3beta-spirostan-5-ene-3-ol-3-O-alpha-L-rhamnopyranosyl-(1->2)-[alpha-L-rhamnopyranosyl-(1->4)]-beta-D-glucopyranoside	present	NPASS
(2R,3S,4R,5R,6S)-2-[(2R,3R,4R)-2,6-dihydroxy-4-methoxyhexan-3-yl]oxy-6-(hydroxymethyl)oxane-3,4,5-triol	present	LOTUS
(2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[(1S,2S,4S,5'S,6R,7S,8R,9S,12S,13R,16S)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-16-yl]oxyoxane-3,4,5-triol	present	NPASS
(2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[(2R)-4-[(1S,2S,4S,6S,7S,8R,9S,12S,13R,16S)-6-hydroxy-7,9,13-trimethyl-16-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-en-6-yl]-2-methylbutoxy]oxane-3,4,5-triol	present	NPASS
(2R,3S,4S,5R,6R)-2-(hydroxymethyl)-6-[(2S)-4-[(1S,2S,4S,6S,7S,8R,9S,12S,13R,16S)-6-hydroxy-7,9,13-trimethyl-16-[(2R,3R,4S,5S,6R)-3,4,5-trihydroxy-6-(hydroxymethyl)oxan-2-yl]oxy-5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-en-6-yl]-2-methylbutoxy]oxane-3,4,5-triol	present	NPASS
(2S,3R,4R,5R,6S)-2-[(2R,3S,4R,5R,6R)-4,5-dihydroxy-2-(hydroxymethyl)-6-[(1S,2S,4S,5'S,6R,7S,8R,9S,12S,13R,16S)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-16-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	NPASS
(2S,3R,4R,5R,6S)-2-[(2R,3S,4S,5R,6R)-4-hydroxy-6-[(1S,2S,3'S,4S,5'R,6S,7S,8R,9S,12S,13R,16S)-3'-hydroxy-5'-(hydroxymethyl)-7,9,13-trimethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-16-yl]oxy-2-(hydroxymethyl)-5-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	NPASS
(2S,3R,4R,5R,6S)-2-[(2R,3S,4S,5R,6R)-4-hydroxy-6-[(1S,2S,3'S,4S,5'S,6S,7S,8R,9S,12S,13R,16S)-3'-hydroxy-5'-(hydroxymethyl)-7,9,13-trimethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-16-yl]oxy-2-(hydroxymethyl)-5-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	NPASS
(2S,3R,4R,5R,6S)-2-[(2S,3R,4S,5R,6S)-4,5-dihydroxy-6-[(2R,3S,4S,5R,6R)-4-hydroxy-2-(hydroxymethyl)-6-[(1S,2S,4S,5'S,6R,7S,8R,9S,12S,13R,16S)-5',7,9,13-tetramethylspiro[5-oxapentacyclo[10.8.0.02,9.04,8.013,18]icos-18-ene-6,2'-oxane]-16-yl]oxy-5-[(2S,3R,4R,5R,6S)-3,4,5-trihydroxy-6-methyloxan-2-yl]oxyoxan-3-yl]oxy-2-methyloxan-3-yl]oxy-6-methyloxane-3,4,5-triol	present	NPASS

05DNA & barcoding4 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adenium obesum has left across the world's sequence archives.

At a glance

DNA specimens4

Marker genes3

GenBank sequences8

eDNA detections10

Countries3

The DNA barcodea real sequence read deposited for this species

ITSKF850555.1 ↗697 bp

ACGT

GCGAACTCGTTTTATCCTCGGGCGCCGGGCGCGGGGGTCCTCCCCCCGCTCGTCTCCCCCGGTCGACCGATGCCTATCGGCTATCGGTCG …

Adenium obesum voucher KSUFS265 internal transcribed spacer 1, partial sequence; 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK3★rbcL4★ITS1

plant barcodefungal barcode

06Genome at a glanceCCDB

The complete instruction manual Adenium obesum carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 22 n = 11

Ploidydiploid inferred

Chromosome records22–222n range22median22mode8records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 228×CCDB · ipcn-api-dl · CCDB · book-indian_vol1 · CCDB · book-fedorov

CCDB · ipcn-api-dl — Laan, F. M. v. d. & J. C. Arends. 1985. Cytotaxonomy of Apocynaceae. Genetica 68: 3–35.

CCDB · ipcn-api-dl — Das, A. B., S. Mohanty & P. Das. 1999. Chromosome number, karyotype and nuclear DNA content in some Adenium species of the family Apocynaceae. Cytobios 98: 95–104.

CCDB · book-indian_vol1 — Tapadar, N.N. Roy 1964a

CCDB · book-fedorov — Tapadar 1964a

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid inferred1×PloiDB · family-scale

PloiDB · family-scale — chromEvol; reliability=1.000 ↗

08Occurrence & distribution

Record type1 100 records

Wild obs. + sensor875

Museum / vouchered222

Cultivated / captive2

Other1

Range

Area of Occupancy AOO2 840 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 322≤1 km 82≤10 km 51>10 km 37

492 georeferenced · 383 without coordinates

Open the mapobservation + sensor875

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy43% within 1 km

≤100 m 4≤1 km 5≤10 km 12

21 georeferenced · 201 without coordinates

Open the institutions mapphysical evidence222

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

Coordinate accuracy

no georeferenced coordinates · 2 records without

Open the mapnot free-living2

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions20 of 38 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kew, GB	44
Saint Louis, US	23
Berlin, DE	19
TAFORI-LSRClocation not on record	10
Yaoundé, CM	6
Edinburgh, GB	6
Wlocation not on record	5
Paris, FR	5
EFGlocation not on record	4
IFAN Ch. A. Dioplocation not on record	4
Uppsala, SE	3
Frankfurt am Main	3
University of Stellenboschlocation not on record	3
Bronx, US	2
Miami, US	2
Gujarat Biodiversity Gene Banklocation not on record	2
Baroda, IN	2
National Museums of Kenyalocation not on record	2
LDlocation not on record	2
Florida Museum of Natural History- Zoology, Paleontology & Paleobotanylocation not on record	2
HNBlocation not on record	2
MeiseBGlocation not on record	2
Bloomington, US	1
Chongqing Museumlocation not on record	1
Cuiabá, BR	1
University of Calabar/Department of Plant and Ecological Studies Herbariumlocation not on record	1
Beijing, CN	1
Centre Suisse de Recherches Scientifiques en Côte d’Ivoirelocation not on record	1
BISHlocation not on record	1
Bangkok, TH	1
Laboratorio de Ictiologialocation not on record	1
Xiamen, CN	1
Taipei, TW	1
Université du Lomélocation not on record	1
Honolulu, US	1
Gump Stationlocation not on record	1
Stockholm, SE	1
Fort Worth, US	1

38 institutions · 169 of 222 vouchered records shown · 52 without an institution code

Cultivated / Captivenot free-living

A living individual in a botanical garden, zoo or nursery — cultivated or kept, not free-living.

09Environmental DNA10 detections

Where the DNA of Adenium obesum was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found10

Studies independent surveys1

Countries3

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 10 detections have coordinates

Open the map3 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.6 °C 18.3–25.9

Seasonal swing summer↔winter9.00 °C

Max temp (day)29.5 °C 24.9–30.4

Min temp (night)19.2 °C 12.1–20.7

Precipitation79.6 mm/mo 0.8–106

Air humidity57.6 % 44.2–59.1

Moisture balance-71.7 mm/mo -118–-51.4

Vapour deficit1,364 Pa 1,048–1,486

Wind speed3.10 m/s 2.60–4.50

Cloud cover42.6 % 16.0–45.7

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Adenium obesum

At a glance

Sources13 archives

Size & morphology3

Life cycle & reproduction8

Diet & foraging1

Habitat & environment8

Physiology & chemistry1

Other traits1

Compound class profile5 classes

Documented compounds84 total

At a glance

Chromosomes & ploidyhow the DNA is packaged

Record type1 100 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Cultivated / Captivenot free-living

Wildobservation + sensor

Holding institutions20 of 38 geolocated

Cultivated / Captivenot free-living

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 100 records