Adenia hondala — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Passifloraceae/Adenia

At a glance

Occurrence records16

Data sources8

Biological traits5

DNA specimens1

eDNA detections1

Sources8 archives

Databases and archives Adenia hondala's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility16 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI1 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics1 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements2 literature sources5 traits

Occurrence & distributionGBIF16 records

Environmental DNA1 datasets · 0 countries1 detections

DNA & barcodingBOLD · NCBI1 specimens

01Narrative

Adenia hondala, commonly known as hondala is a large, tuberous, woody climber which scrambles over other plants. It is found in the Indian subcontinent, including Sri Lanka, and in southeastern Asia. The tuber and the fruit are used as herbal remedies and the plant is used as a cure for snake bites. The caterpillars of several species of butterfly feed on this plant; these include the tawny coster, the clipper, the common cruiser and the Tamil lacewing.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPTRY

Life cycle & reproduction2

Deciduousnessdeciduous

Life formclimber

Habitat & environment3

Climateseasonally dry tropical

Growth formclimber

Woodinesswoody

05DNA & barcoding1 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adenia hondala has left across the world's sequence archives.

At a glance

DNA specimens1

Marker genes1

GenBank sequences3

eDNA detections1

Countries1

The DNA barcodea real sequence read deposited for this species

ITSOR807567.1 ↗268 bpIndia · 2022

ACGT

TGGCTGCTGACATCGAGTTTTTGACGCAAGTTGCGCCCGAAGCCTTCGGGCCGAGGGCACGTCTGCCTGGGTGTCATGTATCGTCGCCTC …

Adenia hondala isolate IMR2021F3 5.8S ribosomal RNA gene and internal transcribed spacer 2, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

ITS3

fungal barcode

08Occurrence & distribution

Record type16 records

Wild obs. + sensor12

Museum / vouchered4

Range

Area of Occupancy AOO56 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy80% within 1 km

≤100 m 2≤1 km 6≤10 km 2

10 georeferenced · 2 without coordinates

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy100% within 1 km

≤1 km 1

1 georeferenced · 3 without coordinates

Open the institutions mapphysical evidence4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 4 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	1
McWane Science Centerlocation not on record	1
University of Stellenboschlocation not on record	1
Pondicherry, IN	1

4 institutions · 4 of 4 vouchered records shown

09Environmental DNA1 detections

Where the DNA of Adenia hondala was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found1

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 1 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.