Adenia digitata

(Harv.) Engl. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malpighiales/Passifloraceae/Adenia

At a glance

Occurrence records424

Data sources9

Biological traits17

DNA specimens9

eDNA detections8

Sources9 archives

Databases and archives Adenia digitata's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility424 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI8 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics9 specimens↗

NCBIUS National Library of Medicinesequences↗

LOTUSNatural Products (Wikidata)compounds↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources17 traits

Chemical compositionLOTUS1 compounds

Occurrence & distributionGBIF424 records

Environmental DNA1 datasets · 2 countries8 detections

DNA & barcodingBOLD · NCBI9 specimens

01Narrative

Adenia digitata is a species of flowering plant in the passionflower family, Passifloraceae. It is native to southern Africa.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPGIFTTRY

Size & morphology4

Plant height3 m

Plant height max3 m

Plant height min0.3 m

Seed mass29.86 mg

Life cycle & reproduction3

Life formclimbing caudex geophyte

Life spanperennial

Self fertilizationabsent

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climatedesert or dry shrubland

Climberobligatory

Elevation max1 830 m

Elevation min5 m

Epiphyteterrestrial

Growth formclimber

Woodinessnon-woody

Physiology & chemistry1

Nitrogen fixingnon_nitrogen_fixer

03Chemical composition1 compounds

Compounds documented for Adenia digitata across natural-product and food-composition databases — not just the ~150 nutrients on a classic label ("nutritional dark matter").

Compound class profile1 class

Cyanogenic glycosides1

Documented compounds1 total

Tissue Source Quantified only

Compound	Class	Amount	Source
Tetraphyllin B		present	LOTUS

05DNA & barcoding9 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adenia digitata has left across the world's sequence archives.

At a glance

DNA specimens9

Marker genes5

GenBank sequences6

eDNA detections8

Countries2

The DNA barcodea real sequence read deposited for this species

ITSDQ521363.1 ↗691 bp

ACGT

TGAACCTGCGGAAGGATCATTGTCGAAACCTGCCCAGCAGAACGACCCGTGAACCCGTTGTGCTATTTGACGCGGGGGGAGGAAAGGTGG …

Adenia digitata voucher D. Hearn cult4 (ARIZ) 18S ribosomal RNA gene, partial sequence; internal transcribed spacer 1, 5.8S ribosomal RNA gene, and internal transcribed spacer 2, complete sequence; and 28S ribosomal RNA gene, partial sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK2★rbcL1★rbcLa★trnL-F★ITS3

plant barcodefungal barcode

08Occurrence & distribution

Record type424 records

Wild obs. + sensor90

Museum / vouchered334

Range

Area of Occupancy AOO1 004 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 57≤1 km 9≤10 km 5>10 km 2

73 georeferenced · 17 without coordinates

Open the mapobservation + sensor90

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤1 km 1≤10 km 1

2 georeferenced · 332 without coordinates

Open the institutions mapphysical evidence334

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 11 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Pretoria, ZA	259
Durban, ZA	20
Instituto de Investigação Científica Tropicallocation not on record	11
Kew, GB	6
Saint Louis, US	6
MeiseBGlocation not on record	3
MSB-3054location not on record	2
Zürich, CH	1
North-West University, A.P. Goossens Herbariumlocation not on record	1
University of Johannesburglocation not on record	1
Edward O. Wilson Biodiversity Laboratory, Gorongosa NPlocation not on record	1

11 institutions · 311 of 334 vouchered records shown · 23 without an institution code

09Environmental DNA8 detections

Where the DNA of Adenia digitata was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found8

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 8 detections have coordinates

Open the map2 countries0

Mixed deciduous Combretum woodland

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median22.4 °C 21.5–26.4

Seasonal swing summer↔winter9.20 °C

Max temp (day)27.2 °C 26.2–31.2

Min temp (night)17.1 °C 16.0–21.8

Precipitation94.9 mm/mo 85.0–186

Air humidity59.0 % 55.2–59.8

Moisture balance-45.6 mm/mo -57.8–10.3

Vapour deficit1,241 Pa 1,076–1,418

Wind speed2.80 m/s 2.70–2.80

Cloud cover31.2 % 28.8–52.6

CHELSA 1981–2010, ~9 km grid, at location & month of 3 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)