Adenanthos sericeus

Labill. · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Proteales/Proteaceae/Adenanthos

At a glance

Occurrence records281

Data sources10

Biological traits19

DNA specimens2

eDNA detections2

Sources10 archives

Databases and archives Adenanthos sericeus's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility281 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI2 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics2 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements3 literature sources19 traits

Occurrence & distributionGBIF281 records

Environmental DNA1 datasets · 0 countries2 detections

DNA & barcodingBOLD · NCBI2 specimens

Genome at a glanceGoaT572 Mbp

01Narrative

Adenanthos sericeus subsp. sericeus, commonly known as coastal woollybush, is a shrub native to the south coast of Western Australia. It has bright red but small and obscure flowers, and very soft, deeply divided, hairy leaves. It is the western subspecies of Adenanthos sericeus (woolly bush), occurring mostly in the vicinity of King George Sound.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesAusTraitsGIFTTRY

Size & morphology6

Leaf mass per area87.8 g/m2

Leaf size305 mm²

Leaf width0.5 mm

Plant height3 m

Plant height max5 m

Plant height min0.5 m

Life cycle & reproduction3

Flowering timeyyyynyyyyyyy

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment8

Aquaticterrestrial

Climberself-supporting

Fruit fleshinessdry

Fruit typeachene

Growth formshrub

⚠ sources differ — GIFT: shrub · AusTraits: shrub tree

Leaf compoundnesssimple

Leaf shapeterete

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding2 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adenanthos sericeus has left across the world's sequence archives.

At a glance

DNA specimens2

Marker genes3

GenBank sequences6

eDNA detections2

The DNA barcodea real sequence read deposited for this species

ITSOZ471163.1 ↗5 889 bp

ACGT

GATGTGTGGCCCATGCGGTGCCGGCTTCGGAAAGGAAAGCTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCC …

Adenanthos sericeus 18S rRNA gene, ITS1, 5.8S rRNA gene, ITS2 and 26S rRNA gene, Isolate SER1-01

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★matK1★rbcL3★ITS2

plant barcodefungal barcode

06Genome at a glanceGoaT

The complete instruction manual Adenanthos sericeus carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size572 130 000 bp

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Adenanthos sericeus0.57 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 26 n = 13

Ploidy2× diploid · measured

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 261×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database — ↗

Ploidy records — measured levels and diploid/polyploid inferences · click for sources

diploid1×GoaT · Kew Plant DNA C-values Database

GoaT · Kew Plant DNA C-values Database

08Occurrence & distribution

Record type281 records

Wild obs. + sensor219

Museum / vouchered62

Origin

Native4

Range

Area of Occupancy AOO456 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 101≤1 km 36≤10 km 11>10 km 19

167 georeferenced · 52 without coordinates

Open the mapobservation + sensor219

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy27% within 1 km

≤100 m 2≤1 km 11≤10 km 16>10 km 20

49 georeferenced · 13 without coordinates

Open the institutions mapphysical evidence62

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions11 of 15 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Brisbane, AU	18
Museo Entomologico de Leonlocation not on record	18
Hobart, AU	5
Mount Annan, AU	4
Kew, GB	3
Claremont, US	2
Armidale, AU	2
BGPAlocation not on record	2
Canberra, AU	2
Stockholm, SE	1
MAlocation not on record	1
Joondalup, AU	1
Parkville, AU	1
Adelaide, AU	1
LDlocation not on record	1

15 institutions · 62 of 62 vouchered records shown

09Environmental DNA2 detections

Where the DNA of Adenanthos sericeus was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found2

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 2 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)