Adenanthos glabrescens — The Life Data

Plantae/Tracheophyta/Magnoliopsida/Proteales/Proteaceae/Adenanthos

At a glance

Occurrence records6

Data sources5

Biological traits20

DNA specimens0

eDNA detections0

Sources5 archives

Databases and archives Adenanthos glabrescens's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 records↗

NCBIUS National Library of Medicinesequences↗

Open Tree of LifeOpenTreephylogeny backbone↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements4 literature sources20 traits

Occurrence & distributionGBIF6 records

DNA & barcodingNCBIsequences

01Narrative

Adenanthos glabrescens is a species of small shrub endemic to the Ravensthorpe area in southwest Western Australia. First published in 1978, there are two subspecies.

No narrative description available for this taxon yet.

02Traits & measurements

SourcesWCVPAusTraitsTRYGIFT

Size & morphology5

Leaf length25 mm

Leaf width6 mm

Plant height0.7 m

⚠ sources differ — AusTraits: 0.7 m · TRY: 0.5 m

Plant height max1.5 m

Plant height min0.3 m

Life cycle & reproduction4

Flowering timennyyyyyyyyyn

Life formshrub

Life spanperennial

Sex typehermaphrodite

Diet & foraging1

Parasiteindependent

Habitat & environment9

Aquaticterrestrial

Climatesubtropical

Climberself-supporting

Fruit fleshinessdry

Fruit typeachene

Growth formshrub

Leaf compoundnesssimple

Leaf shapelanceolate linear obovate ovate

Woodinesswoody

Other traits1

Plant support typefree-standing

05DNA & barcoding4 sequences

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adenanthos glabrescens has left across the world's sequence archives.

At a glance

Marker genes2

GenBank sequences4

The DNA barcodea real sequence read deposited for this species

ITSOZ471047.1 ↗5 884 bp

ACGT

GATGTGTGGCCCATGCGGTGCCGGCTTCGGAAAGGAAAGTTACCTGGTTGATCCTGCCAGTAGTCATATGCTTGTCTCAAAGATTAAGCC …

Adenanthos glabrescens subsp. exasperatus 18S rRNA gene, ITS1, 5.8S rRNA gene, ITS2 and 26S rRNA gene, Isolate GLA1-01

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

rbcL2ITS2

plant barcodefungal barcode

08Occurrence & distribution

Record type6 records

Wild obs. + sensor1

Museum / vouchered5

Range

Area of Occupancy AOO24 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced

Open the mapobservation + sensor1

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy50% within 1 km

≤100 m 2≤10 km 2

4 georeferenced · 1 without coordinates

Open the institutions mapphysical evidence5

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Kensington, AU	4
Paris, FR	1

2 institutions · 5 of 5 vouchered records shown