Adelphia petrella

Zeller, 1846 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Adelphia

At a glance

Occurrence records935

Data sources6

Biological traits0

DNA specimens5

eDNA detections12

Sources6 archives

Databases and archives Adelphia petrella's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility935 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics5 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF935 records

Environmental DNA1 datasets · 1 countries12 detections

DNA & barcodingBOLD5 specimens

01Narrative

Adelphia petrella is een vlinder uit de familie van de snuitmotten (Pyralidae). De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd in 1846 door Zeller.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding5 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adelphia petrella has left across the world's sequence archives.

At a glance

DNA specimens5

BINs1

Marker genes1

eDNA detections12

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus4 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Diversity (π)0.00%

Haplotypes1

BIN1

AACTTTATATTTCATTTTTGGAATTTGATCAGGTATAGTAGGAACATCTTTAAGTCTTTTAATTCGAGCTGAATTAGGAACCCCAGGATC …

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Interjectio columbiellasame family6.5%Pima boisduvaliellasame family6.7%Transcaspia repetekellasame family6.8%Merulempista cingillellasame family7.0%Medaniaria adiacritissame family7.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type935 records

Wild obs. + sensor841

Museum / vouchered94

Range

Area of Occupancy AOO1 096 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy90% within 1 km

≤100 m 592≤1 km 63≤10 km 9>10 km 64

728 georeferenced · 113 without coordinates

Open the mapobservation + sensor841

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy33% within 1 km

≤100 m 2≤1 km 9≤10 km 21>10 km 1

33 georeferenced · 61 without coordinates

Open the institutions mapphysical evidence94

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions5 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	66
Washington, US	8
New Haven, US	6
Georgia Museum of Natural Historylocation not on record	5
CUlocation not on record	3
Ciudad de México, MX	2
Philadelphia, US	2
Smithsonian Institution, National Museum of Natural Historylocation not on record	1
University of Central Floridalocation not on record	1

9 institutions · 94 of 94 vouchered records shown

09Environmental DNA12 detections

Where the DNA of Adelphia petrella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median23.4 °C 14.4–27.7

Seasonal swing summer↔winter17.1 °C

Max temp (day)28.1 °C 18.2–32.4

Min temp (night)18.8 °C 11.5–24.5

Precipitation115 mm/mo 84.4–159

Air humidity61.1 % 58.5–62.4

Moisture balance-35.6 mm/mo -57.4–25.7

Vapour deficit1,117 Pa 663–1,446

Wind speed3.50 m/s 2.20–4.30

Cloud cover33.0 % 27.3–41.8

CHELSA 1981–2010, ~9 km grid, at location & month of 7 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)