Adeloneivaia centrojason

species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Saturniidae/Adeloneivaia

At a glance

Occurrence records19

Data sources3

Biological traits0

DNA specimens259

eDNA detections251

Sources3 archives

Databases and archives Adeloneivaia centrojason's data was compiled from.

GBIFGlobal Biodiversity Information Facility19 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI251 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics259 specimens↗

On this page3 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF19 records

Environmental DNA1 datasets · 5 countries251 detections

DNA & barcodingBOLD259 specimens

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding259 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adeloneivaia centrojason has left across the world's sequence archives.

At a glance

DNA specimens259

BINs1

Marker genes1

eDNA detections251

Countries7

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus248 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 10 variable positions, in barcode order

181Cmostly conserved

193Tmostly conserved

287Tmostly conserved

292Cmostly conserved

343Tmostly conserved

538Cmostly conserved

550Gmostly conserved

586Cmostly conserved

616Tmostly conserved

640Cmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCTGGTATAGTTGGAACCTCATTAAGATTACTAATTCGAGCAGAATTGGGAACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.47%

Haplotypes36

BIN1

Most divergent pair2.9%

N.AmericaS.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adeloneivaia jacolombianasame genus4.6%Adeloneivaia jasonsame genus6.1%Adeloneivaia jametensissame genus6.4%Adeloneivaia jaustralicasame genus6.4%Adeloneivaia cayennsissame genus6.8%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type19 records

Wild obs. + sensor9

Museum / vouchered10

Range

Area of Occupancy AOO48 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 2≤1 km 5≤10 km 1

8 georeferenced · 1 without coordinates

Open the mapobservation + sensor9

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 10 records without

Open the institutions mapphysical evidence10

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
University of Pennsylvanialocation not on record	3
Area de Conservacion Guanacastelocation not on record	3
Research Collection of Rodolphe Rougerielocation not on record	1

3 institutions · 7 of 10 vouchered records shown · 3 without an institution code

09Environmental DNA251 detections

Where the DNA of Adeloneivaia centrojason was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found251

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 251 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median24.1 °C 23.1–25.7

Seasonal swing summer↔winter2.40 °C

Max temp (day)27.2 °C 26.0–29.2

Min temp (night)21.6 °C 20.2–22.9

Precipitation325 mm/mo 65.5–478

Air humidity70.5 % 64.4–74.7

Moisture balance167 mm/mo -98.3–344

Vapour deficit876 Pa 730–1,172

Wind speed2.50 m/s 1.00–4.60

Cloud cover34.2 % 16.1–43.6

CHELSA 1981–2010, ~9 km grid, at location & month of 238 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)