Adeloneivaia catoxantha

Rothschild, 1907 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Saturniidae/Adeloneivaia

At a glance

Occurrence records46

Data sources6

Biological traits0

DNA specimens32

eDNA detections22

Sources6 archives

Databases and archives Adeloneivaia catoxantha's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility46 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics32 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF46 records

Environmental DNA1 datasets · 6 countries22 detections

DNA & barcodingBOLD32 specimens

01Narrative

Adeloneivaia catoxantha is een vlinder uit de familie nachtpauwogen (Saturniidae), onderfamilie Ceratocampinae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd door Rothschild in 1907.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding32 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adeloneivaia catoxantha has left across the world's sequence archives.

At a glance

DNA specimens32

BINs1

Marker genes1

eDNA detections22

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus21 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 14 variable positions, in barcode order

94Tmostly conserved

145Tmostly conserved

157Tmostly conserved

178Cmostly conserved

217Gmostly conserved

271Tmostly conserved

322Avariable

355Cvariable

373Amostly conserved

400Cmostly conserved

479Amostly conserved

538Gvariable

586Tvariable

646Tvariable

AACATTATACTTTATTTTTGGAATTTGAGCTGGAATAGTTGGAACTTCATTAAGATTACTAATTCGAGCTGAATTAGGTACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.76%

Haplotypes10

BIN1

Most divergent pair1.8%

S.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adeloneivaia catobezverkhovisame genus8.2%Adeloneivaia schubartisame genus9.4%Herpetogramma aeglealissame order10.2%Rhiza minutasame order10.2%Herpetogramma sphingealissame order10.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type46 records

Wild obs. + sensor22

Museum / vouchered22

Other2

Range

Area of Occupancy AOO124 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy48% within 1 km

≤100 m 4≤1 km 6>10 km 11

21 georeferenced · 1 without coordinates

Open the mapobservation + sensor22

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 2

2 georeferenced · 20 without coordinates

Open the institutions mapphysical evidence22

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Rouen, ECODIV Laboratorylocation not on record	8
Cleveland Museum of Natural History, OH (CLEV)location not on record	4
New Haven, US	1
Zürich, CH	1
Research Collection of Rodolphe Rougerielocation not on record	1

5 institutions · 15 of 22 vouchered records shown · 7 without an institution code

09Environmental DNA22 detections

Where the DNA of Adeloneivaia catoxantha was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map6 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.5 °C 18.5–26.0

Seasonal swing summer↔winter2.30 °C

Max temp (day)28.5 °C 21.9–29.1

Min temp (night)22.5 °C 14.2–23.0

Precipitation292 mm/mo 124–425

Air humidity69.8 % 66.1–71.7

Moisture balance175 mm/mo -14.5–305

Vapour deficit989 Pa 600–1,034

Wind speed1.30 m/s 0.8–1.80

Cloud cover58.8 % 24.0–64.3

CHELSA 1981–2010, ~9 km grid, at location & month of 20 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)