Adeloneivaia boisduvalii

Doumet, 1859 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Saturniidae/Adeloneivaia

At a glance

Occurrence records568

Data sources6

Biological traits0

DNA specimens87

eDNA detections72

Sources6 archives

Databases and archives Adeloneivaia boisduvalii's data was compiled from.

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility568 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI72 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics87 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF568 records

Environmental DNA1 datasets · 8 countries72 detections

DNA & barcodingBOLD87 specimens

01Narrative

Adeloneivaia boisduvalii is een vlinder uit de familie nachtpauwogen (Saturniidae), onderfamilie Ceratocampinae. De wetenschappelijke naam van de soort is voor het eerst geldig gepubliceerd door Doumet in 1859.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding87 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adeloneivaia boisduvalii has left across the world's sequence archives.

At a glance

DNA specimens87

BINs1

Marker genes1

eDNA detections72

Countries8

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus72 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 96% of positions are identical in every specimen.

Where individuals differ — all 25 variable positions, in barcode order

10Tmostly conserved

25Cvariable

58Cmostly conserved

59Tvariable

82Cmostly conserved

85Avariable

181Amostly conserved

247Cmostly conserved

265Gvariable

271Cmostly conserved

322Amostly conserved

346Tmostly conserved

364Tmostly conserved

412Tmostly conserved

415Amostly conserved

500Cmostly conserved

520Gvariable

532Tvariable

559Gmostly conserved

574Cmostly conserved

586Tmostly conserved

589Tmostly conserved

622Amostly conserved

628Gvariable

640Tmostly conserved

AACTTTATATTTTATCTTTGGAATCTGAGCAGGAATAGTTGGAACTTCATTAAGACTCTTAATTCGAGCAGAATTAGGAACCCCAGGCTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 43 variants.

Diversity (π)1.3%

Haplotypes43

BIN1

Most divergent pair2.9%

S.AmericaN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adeloneivaia peliassame genus7.4%Almeidella approximanssame family8.7%Diastictis argyralissame order9.1%Adelowalkeria caecasame family9.3%Diastictis ventralissame order9.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type568 records

Wild obs. + sensor376

Museum / vouchered189

Other3

Origin

Native1

Range

Area of Occupancy AOO1 224 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy31% within 1 km

≤100 m 78≤1 km 26≤10 km 8>10 km 228

340 georeferenced · 36 without coordinates

Open the mapobservation + sensor376

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy20% within 1 km

≤1 km 1≤10 km 4

5 georeferenced · 184 without coordinates

Open the institutions mapphysical evidence189

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions4 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
National Biodiversity Institute, Costa Ricalocation not on record	140
University of Rouen, ECODIV Laboratorylocation not on record	11
New Haven, US	3
Tallinn, EE	3
Paris, FR	3
Zürich, CH	2
DZ, MNHNlocation not on record	1
Faculty of Pharmacy, Damascus Universitylocation not on record	1
University of Pennsylvanialocation not on record	1
Instituto de Investigación de Recursos Biológicos Alexander von Humboldt (IAvH)location not on record	1
Instituto Nacional de Biodiversidad, Costa Ricalocation not on record	1
Research Collection of Rodolphe Rougerielocation not on record	1

12 institutions · 168 of 189 vouchered records shown · 21 without an institution code

09Environmental DNA72 detections

Where the DNA of Adeloneivaia boisduvalii was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found72

Studies independent surveys1

Countries8

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 72 detections have coordinates

Open the map8 countries0

Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.2 °C 21.4–26.2

Seasonal swing summer↔winter2.00 °C

Max temp (day)27.9 °C 25.2–30.5

Min temp (night)22.1 °C 17.7–23.0

Precipitation233 mm/mo 85.7–440

Air humidity68.4 % 63.8–73.2

Moisture balance106 mm/mo -68.3–324

Vapour deficit984 Pa 748–1,198

Wind speed1.40 m/s 0.8–3.00

Cloud cover39.1 % 23.1–66.7

CHELSA 1981–2010, ~9 km grid, at location & month of 61 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)