Adeloneivaia acuta

Schaus, 1896 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Saturniidae/Adeloneivaia

At a glance

Occurrence records97

Data sources7

Biological traits0

DNA specimens102

eDNA detections39

Sources7 archives

Databases and archives Adeloneivaia acuta's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility97 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI39 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics102 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF97 records

Environmental DNA1 datasets · 5 countries39 detections

DNA & barcodingBOLD102 specimens

01Narrative

Adeloneivaia acuta is a moth of the family Saturniidae. It is found from Venezuela to Paraguay and in the south-east of Brazil, but not in the Amazon.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding102 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adeloneivaia acuta has left across the world's sequence archives.

At a glance

DNA specimens102

BINs4

Marker genes1

eDNA detections39

Countries9

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus68 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 93% of positions are identical in every specimen.

Where individuals differ — all 45 variable positions, in barcode order

16Cvariable

31Tmostly conserved

40Avariable

46Cmostly conserved

82Cvariable

106Cvariable

121Cmostly conserved

133Amostly conserved

163Tvariable

208Amostly conserved

214Amostly conserved

232Tmostly conserved

235Cmostly conserved

250Tmostly conserved

263Tmostly conserved

298Tmostly conserved

313Cvariable

334Amostly conserved

337Tmostly conserved

340Cmostly conserved

373Cmostly conserved

376Tmostly conserved

379Amostly conserved

391Tmostly conserved

400Cmostly conserved

409Avariable

412Ahighly variable

415Amostly conserved

442Cmostly conserved

460Cmostly conserved

466Amostly conserved

472Tmostly conserved

478Tmostly conserved

547Amostly conserved

548Tmostly conserved

550Avariable

562Cmostly conserved

565Amostly conserved

568Tvariable

571Cmostly conserved

580Tvariable

607Amostly conserved

619Amostly conserved

631Amostly conserved

646Tvariable

AACATTATATTTTATCTTTGGAATTTGAGCTGGTATAGTAGGAACCTCATTAAGATTATTAATTCGAGCCGAATTAGGTACCCCCGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.4%

Haplotypes37

BINs4

Most divergent pair5.8%

S.AmericaN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adeloneivaia schubartisame genus8.7%Adeloneivaia fallaxsame genus9.3%Depressaria douglasellasame order9.7%Deinopa delinquenssame order10.0%Parabagrotis insularissame order10.2%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type97 records

Wild obs. + sensor32

Museum / vouchered64

Other1

Range

Area of Occupancy AOO140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy79% within 1 km

≤100 m 12≤1 km 7≤10 km 5

24 georeferenced · 8 without coordinates

Open the mapobservation + sensor32

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy0% within 1 km

≤10 km 1

1 georeferenced · 63 without coordinates

Open the institutions mapphysical evidence64

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 5 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
University of Rouen, ECODIV Laboratorylocation not on record	31
Cleveland Museum of Natural History, OH (CLEV)location not on record	13
New Haven, US	1
South Kensington, GB	1
Research Collection of Rodolphe Rougerielocation not on record	1

5 institutions · 47 of 64 vouchered records shown · 17 without an institution code

09Environmental DNA39 detections

Where the DNA of Adeloneivaia acuta was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found39

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 39 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.5 °C 22.7–26.0

Seasonal swing summer↔winter2.30 °C

Max temp (day)28.5 °C 25.4–30.1

Min temp (night)22.2 °C 19.4–22.2

Precipitation217 mm/mo 149–217

Air humidity69.3 % 59.9–69.8

Moisture balance95.3 mm/mo -4.10–105

Vapour deficit981 Pa 892–1,220

Wind speed0.8 m/s 0.8–2.60

Cloud cover64.3 % 32.0–64.3

CHELSA 1981–2010, ~9 km grid, at location & month of 38 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)