Adelges tsugae

Annand, 1924 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Adelgidae/Adelges

At a glance

Occurrence records6 624

Data sources9

Biological traits0

DNA specimens226

eDNA detections164

Sources9 archives

Databases and archives Adelges tsugae's data was compiled from.

WikipediaWikimedia Foundation4 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility6 624 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI164 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics226 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page5 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF6 624 records

Environmental DNA1 datasets · 5 countries164 detections

DNA & barcodingBOLD226 specimens

Genome at a glanceGoaT · NCBI≈231 Mbp

01Narrative

Bays Mountain Park, Sullivan County, Tennessee. With lacewing (Chrysopidae egg) closeup The hemlock woolly adelgid (; Adelges tsugae), or HWA, is an insect of the order Hemiptera (true bugs) native to East Asia. It feeds by sucking sap from hemlock and spruce trees (Tsuga spp.; Picea spp.). In its native range, HWA is not a serious pest because populations are managed by natural predators and parasitoids and by host resistance. In eastern North America it is a destructive pest that threatens the eastern hemlock (Tsuga canadensis) and the Carolina hemlock (Tsuga caroliniana). HWA is also found in western North America, where it has likely been present for thousands of years. In western North America, it primarily attacks western hemlock Tsuga heterophylla and has only caused minor damage due to natural predators and host resistance. Accidentally introduced to North America from Japan, HWA was first found in the eastern United States near Richmond, Virginia, in 1951. The pest is now found from northern Georgia to coastal Maine and southwestern Nova Scotia. As of 2015, 90% of the geographic range of eastern hemlock in North America has been affected by HWA.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding226 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adelges tsugae has left across the world's sequence archives.

At a glance

DNA specimens226

BINs6

Marker genes2

eDNA detections164

Countries6

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus211 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 90% of positions are identical in every specimen.

Where individuals differ — all 66 variable positions, in barcode order

13Tvariable

46Tvariable

61Tvariable

64Cvariable

74Cvariable

85Tvariable

99Tvariable

103Tvariable

106Tvariable

131Amostly conserved

142Tvariable

154Tvariable

166Amostly conserved

184Amostly conserved

187Tmostly conserved

193Tmostly conserved

202Tvariable

205Avariable

232Avariable

235Cvariable

242Tmostly conserved

250Tvariable

256Amostly conserved

265Tvariable

268Tmostly conserved

271Tvariable

274Avariable

278Cvariable

298Tvariable

301Tmostly conserved

307Tvariable

316Tvariable

340Cvariable

364Amostly conserved

412Avariable

418Tmostly conserved

427Cvariable

439Tmostly conserved

442Tmostly conserved

454Tvariable

457Tmostly conserved

458Tvariable

469Amostly conserved

472Cmostly conserved

490Tmostly conserved

505Tvariable

517Tvariable

518Tvariable

523Tmostly conserved

541Tvariable

547Tvariable

548Tmostly conserved

557Cvariable

568Tmostly conserved

595Tvariable

607Tvariable

610Tvariable

616Cmostly conserved

619Cvariable

622Cvariable

625Gvariable

631Tvariable

634Tmostly conserved

640Tvariable

646Cvariable

653Cvariable

AACTTTATATTTTATATTTGGTATATGATCAGGAATAATTGGATCTTCATTAAGAATAATTATCCGATTAGAACTAAGACAAATTAATTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens. Showing the 28 commonest of 50 variants.

Diversity (π)4.2%

Haplotypes50

BINs6

Most divergent pair9.0%

AsiaN.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Phylloxera coccineasame order9.3%Adelges glandulaesame genus9.7%Pineus coloradensissame family9.9%Adelges pectinataesame genus10.0%same genus10.3%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P18S-5P

animal barcoderibosomal

06Genome at a glanceGoaT · NCBI

The complete instruction manual Adelges tsugae carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈231 002 959 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

THIS GENOME Adelges tsugae0.23 Gb

INSECT0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

07Deep time~67.4 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin67.4 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard periods (Jurassic, Cretaceous…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. The dashed rules marked ✦ are the five great mass extinctions. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock originmass extinction

08Occurrence & distribution

Record type6 624 records

Wild obs. + sensor6 195

Museum / vouchered429

Range

Area of Occupancy AOO14 140 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy89% within 1 km

≤100 m 3 626≤1 km 534≤10 km 168>10 km 353

4 681 georeferenced · 1 514 without coordinates

Open the mapobservation + sensor6 195

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy8% within 1 km

≤1 km 22≤10 km 257>10 km 3

282 georeferenced · 147 without coordinates

Open the institutions mapphysical evidence429

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 6 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	280
Washington, US	21
Cornell University Insect Collectionlocation not on record	6
Canadian Forest Service, Pacific Forestry Centrelocation not on record	1
University Park, US	1
Catholic University of Pekinglocation not on record	1

6 institutions · 310 of 429 vouchered records shown · 119 without an institution code

09Environmental DNA164 detections

Where the DNA of Adelges tsugae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found164

Studies independent surveys1

Countries5

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 164 detections have coordinates

Open the map5 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median10.5 °C 4.50–18.8

Seasonal swing summer↔winter20.9 °C

Max temp (day)15.0 °C 6.90–21.0

Min temp (night)5.80 °C -0.3–14.6

Precipitation113 mm/mo 65.9–322

Air humidity60.5 % 56.2–66.1

Moisture balance41.8 mm/mo -28.0–269

Vapour deficit517 Pa 298–739

Wind speed3.00 m/s 2.00–4.70

Cloud cover44.9 % 37.6–49.9

CHELSA 1981–2010, ~9 km grid, at location & month of 157 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Adelges tsugae

At a glance

Sources9 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

At a glance

When this lineage existed

Record type6 624 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 6 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type6 624 records