Adelges abietis

(Linnaeus, 1758) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Hemiptera/Adelgidae/Adelges

At a glance

Occurrence records1 367

Data sources7

Biological traits0

DNA specimens53

eDNA detections0

Sources7 archives

Databases and archives Adelges abietis's data was compiled from.

WikipediaWikimedia Foundation1 languages↗

GBIFGlobal Biodiversity Information Facility1 367 records↗

BOLD SystemsCentre for Biodiversity Genomics53 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

NCBIUS National Library of Medicinegenome & karyotype↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 367 records

DNA & barcodingBOLD53 specimens

Genome at a glanceGoaT · NCBI≈253 Mbp

01Narrative

A pineapple pseudocone gall on a Norway spruce branch. The Pineapple gall adelgid (Adelges abietis) is a type of conifer-feeding insect that forms pineapple-shaped plant galls on its host species, commonly Norway and Sitka spruce. The adelgids (genus Adelges) are pear-shaped, soft-bodied green insects with long antennae, closely related to the aphid. Adelges lays up to one hundred eggs at a time, one on each needle. Adelges abietis (Linnaeus, 1758) is one of the most common species; synonyms are A. gallarum-abietis, Chermes abietis and Sacciphantes abietis. The pineapple or pseudocone gallDarlington, Arnold (1975) The Pocket Encyclopaedia of Plant Galls in Colour. Pub. Blandford Press. Poole. . P. 114. is a type of insect-formed gall, or abnormal outgrowth of plant tissue, that develops as a chemically induced distortion of needles, observed mostly on Norway spruce and Sitka spruce.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding53 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adelges abietis has left across the world's sequence archives.

At a glance

DNA specimens53

BINs1

Marker genes1

Countries4

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus43 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 100% of positions are identical in every specimen.

Where individuals differ — all 3 variable positions, in barcode order

88Cvariable

334Gmostly conserved

631Amostly conserved

AACTATATACTTTTTATTCGGAATATGATCAGGAATAATTGGATCCTCCCTTAGAATTATTATTCGATTAGAATTAAGACAAATTAACTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.21%

Haplotypes9

BIN1

Most divergent pair0.76%

N.AmericaEurope

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adelges laricissame genus7.8%Adelges kitamiensissame genus7.8%Adelges viridanussame genus7.8%Adelges japonicussame genus7.9%Adelges pectinataesame genus9.0%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Adelges abietis carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈253 165 100 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Adelges abietis0.25 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelChromosome

07Deep time~0.22 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin0.22 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type1 367 records

Wild obs. + sensor1 192

Museum / vouchered175

Range

Area of Occupancy AOO3 716 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy93% within 1 km

≤100 m 706≤1 km 224≤10 km 33>10 km 35

998 georeferenced · 194 without coordinates

Open the mapobservation + sensor1 192

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy26% within 1 km

≤100 m 4≤1 km 30≤10 km 97>10 km 1

132 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence175

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions3 of 7 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
New Haven, US	123
Copenhagen, DK	12
Museum of Zoology at the University of Bergen, Invertebrate Collectionlocation not on record	3
DOI/FWS, Kenai National Wildlife Refugelocation not on record	1
Catholic University of Pekinglocation not on record	1
Cornell University Insect Collectionlocation not on record	1
Champaign, US	1

7 institutions · 142 of 175 vouchered records shown · 33 without an institution code

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Adelges abietis

At a glance

Sources7 archives

At a glance

Genome sizehow big the whole instruction manual is

Sequencing statusassembly quality — how far to trust these numbers

At a glance

When this lineage existed

Record type1 367 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions3 of 7 geolocated

Record type1 367 records