Adela singulella

Walsingham, 1880 · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Adelidae/Adela

At a glance

Occurrence records112

Data sources7

Biological traits0

DNA specimens18

eDNA detections6

Sources7 archives

Databases and archives Adela singulella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility112 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI6 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics18 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF112 records

Environmental DNA1 datasets · 1 countries6 detections

DNA & barcodingBOLD18 specimens

01Narrative

Adela singulella is a moth of the family Adelidae or fairy longhorn moths. It was described by Walsingham in 1880. It is found in California,mothphotographersgroup where it is known from southern Mendocino, Napa and northern Marin Counties. It is also found on the west slope of the Sierra Nevada from El Dorado to Kern County, in the Coast Ranges of Santa Clara County southward, to San Luis Obispo County and then into the San Gabriel Mountains. Adults are on the wing from mid May to mid June north of San Francisco Bay, the central Sierra Nevada and the San Gabriel Mountains. In the southern part of the Coast Range and the southern Sierra Nevada, adults have been recorded in April. The larvae feed on the buds of Gilia capitata and Gilia achilleifolia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding18 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adela singulella has left across the world's sequence archives.

At a glance

DNA specimens18

BINs2

Marker genes1

eDNA detections6

Countries1

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P181 bp consensus11 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 91% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

4Tmostly conserved

19Tmostly conserved

22Amostly conserved

35Tmostly conserved

37Amostly conserved

43Amostly conserved

49Amostly conserved

50Tmostly conserved

61Cvariable

74Tmostly conserved

85Amostly conserved

88Tmostly conserved

112Tmostly conserved

115Cmostly conserved

154Tmostly conserved

166Amostly conserved

169Tmostly conserved

AACTCTTTATTTTATTTTTGGAATTTGATCTGGATTATTAGGAACTTCATTAAGTTTAATCATTCGAACAGAATTAGGAATACCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.5%

Haplotypes5

BINs2

Most divergent pair7.2%

N.America

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type112 records

Wild obs. + sensor75

Museum / vouchered37

Range

Area of Occupancy AOO220 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy82% within 1 km

≤100 m 28≤1 km 8≤10 km 6>10 km 2

44 georeferenced · 31 without coordinates

Open the mapobservation + sensor75

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 37 records without

Open the institutions mapphysical evidence37

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions1 of 2 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Washington, US	36
Smithsonian Institution, National Museum of Natural Historylocation not on record	1

2 institutions · 37 of 37 vouchered records shown

09Environmental DNA6 detections

Where the DNA of Adela singulella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found6

Studies independent surveys1

Countries1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 6 detections have coordinates

Open the map1 country0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median11.6 °C 11.6–11.6

Seasonal swing summer↔winter8.80 °C

Max temp (day)16.2 °C

Min temp (night)7.60 °C

Precipitation53.0 mm/mo

Air humidity59.3 %

Moisture balance-58.6 mm/mo

Vapour deficit554 Pa

Wind speed1.50 m/s

Cloud cover41.0 %

CHELSA 1981–2010, ~9 km grid, at location & month of 1 detection point · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)