Addyme ferrorubella

(Walker, 1864) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pyralidae/Addyme

At a glance

Occurrence records151

Data sources7

Biological traits0

DNA specimens11

eDNA detections12

Sources7 archives

Databases and archives Addyme ferrorubella's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility151 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI12 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics11 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF151 records

Environmental DNA1 datasets · 2 countries12 detections

DNA & barcodingBOLD11 specimens

01Narrative

Addyme ferrorubella is a species of snout moth. It is found in Australia.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding11 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Addyme ferrorubella has left across the world's sequence archives.

At a glance

DNA specimens11

BINs1

Marker genes1

eDNA detections12

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus10 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

43Amostly conserved

133Gmostly conserved

166Gvariable

253Amostly conserved

286Amostly conserved

361Tmostly conserved

401Tmostly conserved

403Amostly conserved

406Tvariable

514Amostly conserved

517Amostly conserved

535Avariable

625Avariable

628Avariable

640Tvariable

AACTTTATATTTTATTTTTGGAATTTGATCAGGTATAGTAGGAACATCTTTAAGTTTATTAATTCGAGCTGAATTAGGTACCCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)0.82%

Haplotypes6

BIN1

Most divergent pair1.7%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Phobus incertussame family7.1%Vietteia terstrigellasame family7.4%Gymnancyla canellasame family7.9%Eurrhypis guttulalissame order8.0%Salebriaria simpliciellasame family8.1%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type151 records

Wild obs. + sensor147

Museum / vouchered4

Range

Area of Occupancy AOO156 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy98% within 1 km

≤100 m 77≤1 km 41>10 km 2

120 georeferenced · 27 without coordinates

Open the mapobservation + sensor147

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 4 records without

Open the institutions mapphysical evidence4

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
Australian National Insect Collectionlocation not on record	1

1 institutions · 1 of 4 vouchered records shown · 3 without an institution code

09Environmental DNA12 detections

Where the DNA of Addyme ferrorubella was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found12

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 12 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median21.2 °C 18.3–23.4

Seasonal swing summer↔winter9.80 °C

Max temp (day)25.1 °C 23.1–27.1

Min temp (night)17.6 °C 12.2–20.8

Precipitation145 mm/mo 85.4–178

Air humidity62.3 % 57.7–69.9

Moisture balance15.0 mm/mo

Vapour deficit904 Pa 758–1,090

Wind speed2.30 m/s

Cloud cover28.8 % 23.2–41.8

CHELSA 1981–2010, ~9 km grid, at location & month of 12 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)