Addaea pusilla

(Butler, 1887) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Thyrididae/Addaea

At a glance

Occurrence records1 914

Data sources6

Biological traits0

DNA specimens76

eDNA detections77

Sources6 archives

Databases and archives Addaea pusilla's data was compiled from.

WikipediaWikimedia Foundation2 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility1 914 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI77 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics76 specimens↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF1 914 records

Environmental DNA1 datasets · 2 countries77 detections

DNA & barcodingBOLD76 specimens

01Narrative

Addaea pusilla is a species of moth of the family Thyrididae. It is found in Papua New GuineaAddaea pusilla - BOLD Systems - Taxonomy Browser and Australia.Australian Faunal Directory

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding76 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Addaea pusilla has left across the world's sequence archives.

At a glance

DNA specimens76

BINs2

Marker genes1

eDNA detections77

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus76 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 97% of positions are identical in every specimen.

Where individuals differ — all 17 variable positions, in barcode order

59Cvariable

157Cmostly conserved

206Cmostly conserved

208Tmostly conserved

277Amostly conserved

287Cvariable

337Tmostly conserved

364Amostly conserved

379Tmostly conserved

385Tmostly conserved

403Tmostly conserved

478Gvariable

529Tmostly conserved

532Cvariable

607Avariable

616Tvariable

658Tmostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACATCTTTAAGTTTACTAATTCGAGCAGAATTAGGAAATCCAGGTTC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.1%

Haplotypes11

BINs2

Most divergent pair2.9%

Oceania

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Addaea polyphoralissame genus5.5%Addaea heliopsammasame genus5.8%Addaea candidalissame genus6.2%Addaea fragilissame genus6.7%Eutelia adulatrixsame order7.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type1 914 records

Wild obs. + sensor12

Museum / vouchered1 902

Range

Area of Occupancy AOO92 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy100% within 1 km

≤100 m 7≤1 km 2

9 georeferenced · 3 without coordinates

Open the mapobservation + sensor12

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 1 902 records without

Open the institutions mapphysical evidence1 902

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

09Environmental DNA77 detections

Where the DNA of Addaea pusilla was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found77

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 77 detections have coordinates

Open the map2 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median25.6 °C 24.5–26.0

Seasonal swing summer↔winter0.7 °C

Max temp (day)28.2 °C 27.8–29.4

Min temp (night)22.4 °C 21.4–23.4

Precipitation226 mm/mo 152–634

Air humidity70.2 % 68.0–72.8

Moisture balance102 mm/mo 22.9–489

Vapour deficit949 Pa 869–1,062

Wind speed0.9 m/s 0.4–1.90

Cloud cover50.7 % 45.0–55.6

CHELSA 1981–2010, ~9 km grid, at location & month of 77 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Addaea pusilla

At a glance

Sources6 archives

At a glance

Record type1 914 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type1 914 records