Adansonia rubrostipa

Jum. & Perrier · species

image placeholder — illustration coming later

Plantae/Tracheophyta/Magnoliopsida/Malvales/Malvaceae/Adansonia

At a glance

Occurrence records576

Data sources10

Biological traits7

DNA specimens3

eDNA detections3

Sources10 archives

Databases and archives Adansonia rubrostipa's data was compiled from.

WikipediaWikimedia Foundation5 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility576 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI3 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics3 specimens↗

NCBIUS National Library of Medicinesequences↗

GRIN TaxonomyUSDA-ARSdistribution & uses↗

Open Tree of LifeOpenTreephylogeny backbone↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

WikidataWikimedia Foundationstructured facts↗

On this page6 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Traits & measurements1 literature sources7 traits

Occurrence & distributionGBIF576 records

Environmental DNA1 datasets · 0 countries3 detections

DNA & barcodingBOLD · NCBI3 specimens

Genome at a glanceGoaT · NCBI≈727 Mbp

01Narrative

Adansonia rubrostipa, commonly known as fony baobab, is a deciduous tree in the Malvaceae family. Of eight species of baobab currently recognized, six are indigenous to Madagascar, including fony baobab. It is endemic to western Madagascar, found from Parc Nationale Baie de Baly, south.Letsara, R., Faranirina, L., Razafindrahaja, V. & Faramalala, M. 2019. Adansonia rubrostipa. The IUCN Red List of Threatened Species 2019: e.T37679A64366919. https://dx.doi.org/10.2305/IUCN.UK.2019-3.RLTS.T37679A64366919.en. Downloaded on 08 July 2020 It is associated with well-drained soils and is found in dry and spiny forests. It occurs in the following protected areas: Amoron'i Onilahy, Baie de Baly, Menabe Antimena, Mikea, Namoroka, Ranobe PK 32, Tsimanampesotse, Tsimembo Manambolomaty, Tsinjoriake (La Table/St Augustin). Fony baobab is the smallest of the baobabs, easily identified by its distinctive reddish bark. It is usually bottle-shaped and has toothed leaves and round fruit.Behrens, K. and K. Barnes. 2016. Wildlife of Madagascar. Wild guides, Princeton University Press. It was first described by H.Perrier de la Bathie in 1909.Baum, D.A., 1995, A Systematic Revision of Adansonia (Bombacaceae). Annals of the Missouri Botanical Garden , 1995, Vol. 82, No. 3 (1995), pp. 440-471

No narrative description available for this taxon yet.

02Traits & measurements

SourcesTRY

Size & morphology2

Plant height25 m

Seed mass760 mg

Life cycle & reproduction1

Deciduousnessdeciduous

Habitat & environment1

Woodinesswoody

Physiology & chemistry2

Photosynthetic pathwayC3

Wood density410 mg/cm³

Other traits1

Plant support typefree-standing

05DNA & barcoding3 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adansonia rubrostipa has left across the world's sequence archives.

At a glance

DNA specimens3

Marker genes2

GenBank sequences6

eDNA detections3

Countries1

The DNA barcodea real sequence read deposited for this species

ITSKF760384.1 ↗708 bpMadagascar

ACGT

CTTGCCCCGCAAACCGACCCGCGAACACGTTAGTTAACGACACCGCCGGGGGGTGAGGGTGCCGTCGCGCCCCGAGCCCCCTCGGCACCC …

Adansonia rubrostipa isolate Aru1 internal transcribed spacer 1, partial sequence; and 5.8S ribosomal RNA gene and internal transcribed spacer 2, complete sequence

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★rbcL2★ITS4

plant barcodefungal barcode

06Genome at a glanceGoaT · NCBI

The complete instruction manual Adansonia rubrostipa carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Genome sizehow big the whole instruction manual is

Genome size≈727 124 410 bp assembly estimate

Measured in base pairs (bp) — the individual letters of DNA (human ≈ 3.2 Gb, a bacterium a few million). The chart places this genome on a logarithmic scale — each step to the right is ten times bigger — among reference organisms. Across species a bigger genome loosely tracks with larger cells, slower growth and lower-energy lifestyles (powered flight favours small genomes) — yet it does not imply more genes or a more advanced organism (the long-standing C-value paradox).

BACTERIUM Carsonella ruddii0.00016 Gb

FUNGUS0.04 Gb

INSECT0.25 Gb

THIS GENOME Adansonia rubrostipa0.73 Gb

HUMAN3.2 Gb

WHEAT17 Gb

FERN Tmesipteris160.45 Gb

Sequencing statusassembly quality — how far to trust these numbers

Assembly level tells you how finished the sequence is — from fragmented contigs, through scaffolds, up to a full chromosome-level assembly. BUSCO % estimates completeness: the share of genes expected to be present that were actually found. These describe the data quality, not the organism.

Assembly levelScaffold

07Deep time~0 Ma lineage

How far back this lineage goes — and how we know. Everything here is measured in Ma, short for “mega-annum”: millions of years ago. The chart reads left to right like a calendar of the Earth, from the deep past on the left to today at the right edgetop to bottom like a core drilled through the Earth, from the deep past at the top down to today at the bottom.

At a glance

DNA clock origin0 Ma TimeTree

When this lineage existed

How to read this: the coloured strip along the bottomdown the left is the geological calendar — the standard epochs (Pliocene, Pleistocene…) every museum uses, shown so you can see which chapter of Earth's history this lineage lived in. This lineage is a young one, so the strip is zoomed in to epochs — the finer subdivisions inside a period. The orange marker is the DNA clock: DNA accumulates mutations at a roughly steady rate, so comparing this species' DNA with its relatives estimates when the lineage split off — independently of any fossil.

DNA clock origin

08Occurrence & distribution

Record type576 records

Wild obs. + sensor447

Museum / vouchered129

Range

Area of Occupancy AOO1 272 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy0% within 1 km

≤1 km 1≤10 km 3>10 km 443

447 georeferenced

Open the mapobservation + sensor447

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy

no georeferenced coordinates · 129 records without

Open the institutions mapphysical evidence129

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions6 of 12 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Paris, FR	47
Plocation not on record	28
Saint Louis, US	15
Parc Botanique et Zoologique de Tsimbazaza (PBZT)location not on record	10
Centre National de la Recherche Appliquée au Developement Rurallocation not on record	8
Kew, GB	3
University of Stellenboschlocation not on record	3
Stockholm, SE	2
Embrapa Agrobiology Diazothrophic Microbial Culture Collectionlocation not on record	1
CASlocation not on record	1
Ypsilanti, US	1
Ann Arbor, US	1

12 institutions · 120 of 129 vouchered records shown · 9 without an institution code

09Environmental DNA3 detections

Where the DNA of Adansonia rubrostipa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found3

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 3 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)