Adalia frigida

(Schneider, 1792) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Coleoptera/Coccinellidae/Adalia

At a glance

Occurrence records96

Data sources5

Biological traits0

DNA specimens35

eDNA detections22

Sources5 archives

Databases and archives Adalia frigida's data was compiled from.

GBIFGlobal Biodiversity Information Facility96 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI22 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics35 specimens↗

GoaTGenomes on a Tree · Sangergenome & karyotype↗

Tree of SexTree of Sex Consortiumgenome & karyotype↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

Occurrence & distributionGBIF96 records

Environmental DNA1 datasets · 0 countries22 detections

DNA & barcodingBOLD35 specimens

Genome at a glanceGoaT · TreeOfSex2n = 20

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding35 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adalia frigida has left across the world's sequence archives.

At a glance

DNA specimens35

BINs3

Marker genes1

eDNA detections22

Countries3

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P670 bp consensus35 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 94% of positions are identical in every specimen.

Where individuals differ — all 38 variable positions, in barcode order

14Amostly conserved

17Avariable

26Avariable

32Cmostly conserved

33Tmostly conserved

44Amostly conserved

95Tmostly conserved

98Avariable

101Gmostly conserved

126Cmostly conserved

152Avariable

164Cvariable

176Avariable

179Gvariable

200Tmostly conserved

224Avariable

257Amostly conserved

290Avariable

299Tvariable

302Tmostly conserved

308Avariable

314Gvariable

344Tvariable

348Tvariable

398Cmostly conserved

407Gvariable

422Avariable

434Cvariable

443Avariable

446Tvariable

479Avariable

491Cvariable

551Tvariable

554Avariable

557Avariable

566Tvariable

605Tvariable

638Tvariable

CTATTATAAATATACGACCTAATGGAATAAACTTAGATAAAACACCTTTATTTGTTTGATCAGTTTTAATTACAGCTATTCTACTACTTT …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)2.5%

Haplotypes18

BINs3

Most divergent pair4.5%

Europe

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Adalia bipunctatasame genus3.4%Adalia tetraspilotasame genus5.1%Haemagogus anastasionissame order15.0%Deinocerites atlanticussame order15.2%Aphaenops crypticolasame order15.6%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

06Genome at a glanceGoaT · TreeOfSex

The complete instruction manual Adalia frigida carries — its genome. We read it from three angles — how big it is, how the DNA is packed into chromosomes, and how completely it has been sequenced — and explain how to read each value as you go.

Chromosomes & ploidyhow the DNA is packaged

2n is the full chromosome count in a normal body cell; n is a gamete (egg or sperm), which carries half. Ploidy is how many complete chromosome sets each cell holds — 2× (diploid) is typical for animals, while higher levels (polyploidy) are common in plants. Click any value below to see the underlying records and sources.

Chromosomes2n = 20 n = 10

Chromosome records20–202n range20median20mode2records

Chromosome-count records — grouped by value · 2n = full set, n = gamete · click a value for sources & references

2n 202×GoaT · Animal Chromosome Counts Database · TreeOfSex · invert

GoaT · Animal Chromosome Counts Database — ↗

TreeOfSex · invert — Smith SG, Virkki N (1978) Animal Cytogenetics Vol. 3 Insecta 5 Coleoptera. Berlin: Gebruder Borntraeger. ↗

08Occurrence & distribution

Record type96 records

Wild obs. + sensor10

Museum / vouchered83

Fossil3

Range

Area of Occupancy AOO188 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy88% within 1 km

≤100 m 4≤1 km 3≤10 km 1

8 georeferenced · 2 without coordinates

Open the mapobservation + sensor10

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy78% within 1 km

≤100 m 7≤1 km 18≤10 km 6>10 km 1

32 georeferenced · 51 without coordinates

Open the institutions mapphysical evidence83

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Institution	Specimens
OSUClocation not on record	41
SLU Artdatabankenlocation not on record	23
Royal Saskatchewan Museumlocation not on record	8
NTNU-VMlocation not on record	6
Espace pour la vielocation not on record	3
CUlocation not on record	1

6 institutions · 82 of 83 vouchered records shown · 1 without an institution code

09Environmental DNA22 detections

Where the DNA of Adalia frigida was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found22

Studies independent surveys1

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 22 detections have coordinates

Open the map0 countries0

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)