Adaina ambrosiae

(Murtfeldt, 1880) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Pterophoridae/Adaina

At a glance

Occurrence records858

Data sources8

Biological traits0

DNA specimens23

eDNA detections46

Sources8 archives

Databases and archives Adaina ambrosiae's data was compiled from.

WikipediaWikimedia Foundation3 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility858 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI46 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics23 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

Catalogue of LifeCOLtaxonomy↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF858 records

Environmental DNA1 datasets · 2 countries46 detections

DNA & barcodingBOLD23 specimens

01Narrative

Adaina ambrosiae (ambrosia plume moth or ragweed plume moth) is a moth of the family Pterophoridae. It is found in North America from California east to Florida and north to Ontario.Bug Guide It is also known from Bermuda, Costa Rica, Jamaica, Puerto Rico and the Virgin Islands. The wingspan is 13 -. The forewings are brownish‑white and the markings are dark brown. The hindwings and fringes are grey. Adults are on wing nearly year round in the southern part of their range. The larvae feed on Ambrosia artemissiifolia, Ambrosia acanthicarpa, Ambrosia chamissonis, Ambrosia confertiflora, Ambrosia dumosa, Ambrosia eriocentra, Ambrosia cumanensis, Pluchea rosea, Melanthera nivea, Helianthus annuus, Helianthus tuberosa, Xanthium strumarium and Cynara scolymus.Annotated Checklist of the Pterophoridae (Lepidoptera) of Florida They skeletonize the leaves of their host plant. They rest along the midrib of the upper leaf surface in depressions which they carve into the leaves.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding23 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Adaina ambrosiae has left across the world's sequence archives.

At a glance

DNA specimens23

BINs2

Marker genes1

eDNA detections46

Countries2

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus22 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 95% of positions are identical in every specimen.

Where individuals differ — all 31 variable positions, in barcode order

38Gmostly conserved

82Tmostly conserved

100Amostly conserved

106Tmostly conserved

178Tmostly conserved

193Tmostly conserved

211Gmostly conserved

212Tmostly conserved

235Tmostly conserved

238Tmostly conserved

259Tmostly conserved

263Cmostly conserved

265Tmostly conserved

266Cmostly conserved

268Tmostly conserved

277Amostly conserved

280Tmostly conserved

346Amostly conserved

349Amostly conserved

364Tmostly conserved

403Tmostly conserved

412Cmostly conserved

427Tmostly conserved

479Amostly conserved

533Tmostly conserved

542Tmostly conserved

568Amostly conserved

571Tmostly conserved

634Cvariable

640Tmostly conserved

655Amostly conserved

AACTTTATATTTTATTTTTGGAATTTGAGCTGGAATAGTTGGTACTTCTTTAAGTTTATTAATTCGAGCTGAATTAGGTAATCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.7%

Haplotypes6

BINs2

Most divergent pair4.9%

N.America

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Psilocorsis cryptolechiellasame order8.1%Smyra aexoniasame order8.5%Emarginea gammophorasame order8.5%Catocala dulasame order8.5%Stenoprora perspicuasame order8.5%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type858 records

Wild obs. + sensor791

Museum / vouchered67

Range

Area of Occupancy AOO1 720 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy81% within 1 km

≤100 m 429≤1 km 103≤10 km 25>10 km 96

653 georeferenced · 138 without coordinates

Open the mapobservation + sensor791

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy42% within 1 km

≤100 m 2≤1 km 8≤10 km 11>10 km 3

24 georeferenced · 43 without coordinates

Open the institutions mapphysical evidence67

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions2 of 8 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Mississippi State, US	52
ASUlocation not on record	4
CUlocation not on record	2
King Saud Universitylocation not on record	2
Georgia Museum of Natural Historylocation not on record	2
University of Guelph, Centre for Biodiversity Genomicslocation not on record	1
East Lansing, US	1
Essig Museum of Entomologylocation not on record	1

8 institutions · 65 of 67 vouchered records shown · 2 without an institution code

09Environmental DNA46 detections

Where the DNA of Adaina ambrosiae was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found46

Studies independent surveys1

Countries2

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 46 detections have coordinates

Open the map2 countries0

Saltmarsh/CSS

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median18.7 °C 18.7–24.9

Seasonal swing summer↔winter20.5 °C

Max temp (day)26.2 °C 25.9–29.8

Min temp (night)12.6 °C 12.6–21.0

Precipitation43.0 mm/mo 43.0–113

Air humidity47.8 % 47.8–57.3

Moisture balance-50.8 mm/mo -76.2–-19.1

Vapour deficit1,127 Pa 944–1,332

Wind speed2.80 m/s 2.80–4.70

Cloud cover47.8 % 29.5–47.8

CHELSA 1981–2010, ~9 km grid, at location & month of 44 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)