Acytolepis puspa

(Horsfield, 1828) · species

image placeholder — illustration coming later

Animalia/Arthropoda/Insecta/Lepidoptera/Lycaenidae/Acytolepis

At a glance

Occurrence records5 253

Data sources7

Biological traits0

DNA specimens75

eDNA detections77

Sources7 archives

Databases and archives Acytolepis puspa's data was compiled from.

WikipediaWikimedia Foundation7 languages↗

BioWikiNetmultilingual Wikipediamultilingual↗

GBIFGlobal Biodiversity Information Facility5 253 records↗

ENAEuropean Nucleotide Archive · EMBL-EBI77 eDNA detections↗

BOLD SystemsCentre for Biodiversity Genomics75 specimens↗

Open Tree of LifeOpenTreephylogeny backbone↗

GLoBIGlobal Biotic Interactionsbiotic interactions↗

On this page4 sections

Every layer below draws on the sources above — open one to explore it, or use ← → to move between tabs.

NarrativeWikipediaarticle

Occurrence & distributionGBIF5 253 records

Environmental DNA1 datasets · 6 countries77 detections

DNA & barcodingBOLD75 specimens

01Narrative

Acytolepis puspa, the common hedge blue,"Acytolepis Toxopeus, 1927" at Markku Savela's Lepidoptera and Some Other Life Forms is a small butterfly found in Cambodia, India, Myanmar, Thailand, Yunnan, Taiwan, Sri Lanka, Philippines, Borneo and New Guinea that belongs to the lycaenids or blues family. The species was first described by Thomas Horsfield in 1828.

No narrative description available for this taxon yet.

02Traits & measurements

No structured trait data for this taxon yet.

05DNA & barcoding75 specimens

A DNA barcode is a short, standardised stretch of genes that works like a fingerprint — enough to tell one species from another. Below is the molecular trace Acytolepis puspa has left across the world's sequence archives.

At a glance

DNA specimens75

BINs1

Marker genes1

eDNA detections77

Countries14

The DNA barcodethe species' typical barcode, built from every sequenced specimen

COI-5P658 bp consensus32 specimens

ACGT

▸ drag or hover over the strip to read any position — letter and how much it varies

Violet ticks below the strip = positions where individuals differ; flat = the species' unchanging signature. 98% of positions are identical in every specimen.

Where individuals differ — all 15 variable positions, in barcode order

34Tvariable

82Cvariable

106Tmostly conserved

157Tmostly conserved

223Cmostly conserved

277Tvariable

286Amostly conserved

325Cvariable

415Cvariable

448Cvariable

482Tmostly conserved

514Amostly conserved

533Tmostly conserved

616Tvariable

625Amostly conserved

AACATTATATTTTATTTTTGGAATTTGAGCAGGTATACTAGGAACATCATTAAGAATTTTAATTCGAATAGAATTAGGAACCCCTGGATC …

Variant network

Each circle is a barcode variant; bigger = more specimens, colour = region. Lines join the most similar variants and the tick marks count the mutations between them — a tight cluster is one “dialect”, a long line a more divergent lineage. Click a circle to list its actual specimens.

Diversity (π)1.0%

Haplotypes7

BIN1

Most divergent pair1.7%

AsiaOther

Closest relatives by DNA barcode

The species whose COI barcode is most similar to this one — a quick “who is this most like”. The percentage is how much the barcode differs; it approximates, but is not, the full evolutionary tree.

Callenya melaenasame family6.2%Celastrina nigrasame family6.4%Celastrina argiolussame family6.4%Celastrina ladonsame family6.4%Celastrina luciasame family6.4%

Marker genes sequenced

★ the standard DNA barcode for this group — the short region actually read to tell this species apart. The rest are extra genes sequenced along the way.

★COI-5P

animal barcode

08Occurrence & distribution

Record type5 253 records

Wild obs. + sensor5 154

Museum / vouchered75

Other24

Range

Area of Occupancy AOO7 436 km²

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

Coordinate accuracy72% within 1 km

≤100 m 1 309≤1 km 1 657≤10 km 582>10 km 590

4 138 georeferenced · 1 016 without coordinates

Open the mapobservation + sensor5 154

Museum / Voucheredphysical evidence

Backed by a physical specimen — a herbarium sheet, sample or voucher held in a collection. “Vouchered” means supported by material evidence, not just an observation.

Coordinate accuracy5% within 1 km

≤1 km 1≤10 km 7>10 km 14

22 georeferenced · 53 without coordinates

Open the institutions mapphysical evidence75

Wildobservation + sensor

Human sightings and records, or camera-trap / sensor detections — someone (or a device) saw or captured the species in the wild.

10Collections & institutions

Holding institutions7 of 9 geolocated

Institutions and collections holding physical, vouchered specimens of this species — click a row to fly to it on the map.

Institution	Specimens
Yamaguchi-shi, JP	16
Cambridge, US	11
Tokushima, JP	7
Helsinki, FI	6
University of Malaya, Museum of Zoologylocation not on record	6
Smithsonian Tropical Research Institute, Center for Tropical Forest Science, Khao Chong, Arthropod Laboratorylocation not on record	2
Zürich, CH	2
JP	1
Toronto, CA	1

9 institutions · 52 of 75 vouchered records shown · 23 without an institution code

09Environmental DNA77 detections

Where the DNA of Acytolepis puspa was picked up in samples of water, soil or air — nobody saw the organism, only its DNA left behind. A trace is a clue that the species was near, not a confirmed sighting.

Signal

Detections DNA found77

Studies independent surveys1

Countries6

Signal confidence: weakweighed across independent studies, places & mapped detections

Where its DNA was found

0 of 77 detections have coordinates

Open the map6 countries0

1. Forest & Woodland|1.9. Subtropical/Tropic…Forest

How strong is each trace?

DNA read depthRead counts were not reported for this species — the map shows presence only, not how strong each trace was.

Modelled climatemodelled

−15°Ctemperature across detection sites+40°C

Temperature median26.2 °C 22.9–28.0

Seasonal swing summer↔winter7.20 °C

Max temp (day)29.4 °C 27.1–30.6

Min temp (night)23.5 °C 17.6–25.5

Precipitation285 mm/mo 139–406

Air humidity67.3 % 62.0–69.2

Moisture balance139 mm/mo -7.20–257

Vapour deficit1,159 Pa 965–1,233

Wind speed2.40 m/s 1.10–2.90

Cloud cover52.8 % 29.4–69.3

CHELSA 1981–2010, ~9 km grid, at location & month of 35 detection points · median with p10–p90 · reflects where sampling happened, not only the true niche

How to read this: each dot is one detection of this species' DNA in an environmental sample. The confidence meter weighs how many independent studies and places back up the signal — one detection in one study is a hint; many across several studies is solid. Records dated before 2008 (when eDNA methods began) are treated as likely mislabeled and left off the map.

←→tabs

The Life Data · species page · narrative wired to read_model image placeholder · 3D tilt requires an http server (WebGL)

Acytolepis puspa

At a glance

Sources7 archives

At a glance

Record type5 253 records

Range

Wildobservation + sensor

Museum / Voucheredphysical evidence

Wildobservation + sensor

Holding institutions7 of 9 geolocated

Signal

Where its DNA was found

How strong is each trace?

Modelled climatemodelled

Record type5 253 records